ID: 1061860733

View in Genome Browser
Species Human (GRCh38)
Location 9:133467530-133467552
Sequence GGAATCTCCACCGCGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 37}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061860733_1061860742 14 Left 1061860733 9:133467530-133467552 CCCCTCTCCGCGGTGGAGATTCC 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1061860742 9:133467567-133467589 CGAAGCTAGTAGGTCCTGGATGG No data
1061860733_1061860743 15 Left 1061860733 9:133467530-133467552 CCCCTCTCCGCGGTGGAGATTCC 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1061860743 9:133467568-133467590 GAAGCTAGTAGGTCCTGGATGGG No data
1061860733_1061860740 10 Left 1061860733 9:133467530-133467552 CCCCTCTCCGCGGTGGAGATTCC 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1061860740 9:133467563-133467585 CCCGCGAAGCTAGTAGGTCCTGG No data
1061860733_1061860738 4 Left 1061860733 9:133467530-133467552 CCCCTCTCCGCGGTGGAGATTCC 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1061860738 9:133467557-133467579 AACTTGCCCGCGAAGCTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061860733 Original CRISPR GGAATCTCCACCGCGGAGAG GGG (reversed) Intronic
901676728 1:10889706-10889728 GGAATCTCCAGCGGGGTGTGGGG + Intergenic
902657471 1:17879251-17879273 GGCATGTCCAGCCCGGAGAGGGG - Intergenic
912715830 1:111982925-111982947 GAAATCCCCACCACAGAGAGGGG + Intronic
922950198 1:229552807-229552829 GGAATCTCGAACACAGAGAGAGG + Intronic
1062857085 10:784777-784799 GGAAGCTCCCACGCGCAGAGGGG - Intergenic
1063377184 10:5561400-5561422 GGAGCCTCCACTGCAGAGAGGGG + Intergenic
1064397998 10:14996465-14996487 GTAATATCCAGCGGGGAGAGCGG + Intergenic
1070114718 10:73517283-73517305 GGAATAGCCACCTCTGAGAGGGG - Exonic
1073148034 10:101293051-101293073 GAGATCTCCTCCTCGGAGAGGGG - Intergenic
1081636170 11:44723688-44723710 GAAGTCTCCACCAAGGAGAGGGG - Intergenic
1094514649 12:31119703-31119725 GGGATCCCCATCGCGGGGAGGGG + Intergenic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1108063459 13:46554100-46554122 GGGAACTCCAGCGCGGACAGCGG + Intronic
1118747909 14:68787046-68787068 GGAATGTCCAGCGGGGTGAGGGG - Intergenic
1124500105 15:30220902-30220924 GGAATCTCCACCTGGAAGTGAGG + Intergenic
1124743470 15:32317764-32317786 GGAATCTCCACCTGGAAGTGAGG - Intergenic
1127865197 15:63026883-63026905 GGGAGCTCCACAGCTGAGAGGGG - Intergenic
1127972811 15:63975037-63975059 GGAATCTCCTTGGCTGAGAGAGG + Intronic
1134634714 16:15783578-15783600 GGAATCACCACAGCTGAGACTGG + Intronic
1142631419 17:1228933-1228955 GGGGTCTCCTCCGCGGCGAGGGG + Intronic
1144637601 17:16920226-16920248 GGGATCTCCACCGTGAGGAGTGG - Intergenic
1144708443 17:17385011-17385033 GGAAACACCAGTGCGGAGAGAGG + Intergenic
1158427804 18:57354072-57354094 GGAATCAGCACCGCGGACAGCGG - Intronic
1160548759 18:79679936-79679958 GGCACCTCCATCGCGGACAGAGG - Exonic
1161267353 19:3370391-3370413 GGCACCTCCGCCGCAGAGAGGGG - Intronic
1161917699 19:7241782-7241804 GCAGTCCCCACCACGGAGAGGGG + Intronic
1167257826 19:48441972-48441994 GGGATTTCCACAGCGGAGAGGGG + Intronic
1171192067 20:23165810-23165832 GCCATCTCCTCCACGGAGAGTGG + Intergenic
1184660552 22:45963696-45963718 GGAATCTCCACCGTGGAAGGCGG + Intronic
955724570 3:61919485-61919507 GGAAACTCCATCGTGGAGGGAGG - Intronic
957776498 3:84761304-84761326 GGACTCTCTACCTTGGAGAGGGG + Intergenic
974268733 4:59621610-59621632 GGAATCTCTACGAAGGAGAGAGG + Intergenic
974925086 4:68287995-68288017 GGAATCTCCAACTGGGATAGTGG - Intergenic
978019065 4:103786071-103786093 GTAATCTCCAGGGCAGAGAGAGG - Intergenic
981170801 4:141621147-141621169 GGAATCTCCTACACTGAGAGTGG + Intergenic
1016412251 6:143795640-143795662 GGAAGCTCCATGGAGGAGAGAGG + Intronic
1026795574 7:73364106-73364128 GGAGATTCCACCGCGGGGAGAGG - Intergenic
1039713880 8:40087782-40087804 GGAGTCTCCAAAGCTGAGAGAGG - Intergenic
1049150483 8:141032145-141032167 GGAAGCTCCACCGCGGTGGAGGG + Intergenic
1061725976 9:132582274-132582296 GGCATCAGCACCGCGGAGAGCGG - Exonic
1061860733 9:133467530-133467552 GGAATCTCCACCGCGGAGAGGGG - Intronic
1200918673 Y:8593675-8593697 GGAAGCCCCACCTGGGAGAGAGG - Intergenic