ID: 1061861253

View in Genome Browser
Species Human (GRCh38)
Location 9:133469743-133469765
Sequence CCGACCAGGCACCTGCCCGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 107}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061861253_1061861259 -3 Left 1061861253 9:133469743-133469765 CCATCGGGCAGGTGCCTGGTCGG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1061861259 9:133469763-133469785 CGGGCCTGGCTTAGCCCAGGTGG 0: 1
1: 0
2: 1
3: 13
4: 195
1061861253_1061861261 -1 Left 1061861253 9:133469743-133469765 CCATCGGGCAGGTGCCTGGTCGG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1061861261 9:133469765-133469787 GGCCTGGCTTAGCCCAGGTGGGG 0: 1
1: 0
2: 2
3: 26
4: 275
1061861253_1061861263 4 Left 1061861253 9:133469743-133469765 CCATCGGGCAGGTGCCTGGTCGG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1061861263 9:133469770-133469792 GGCTTAGCCCAGGTGGGGTTTGG 0: 1
1: 0
2: 2
3: 14
4: 183
1061861253_1061861260 -2 Left 1061861253 9:133469743-133469765 CCATCGGGCAGGTGCCTGGTCGG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1061861260 9:133469764-133469786 GGGCCTGGCTTAGCCCAGGTGGG 0: 1
1: 0
2: 4
3: 27
4: 273
1061861253_1061861266 13 Left 1061861253 9:133469743-133469765 CCATCGGGCAGGTGCCTGGTCGG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1061861266 9:133469779-133469801 CAGGTGGGGTTTGGCAGAAGCGG 0: 1
1: 0
2: 1
3: 29
4: 306
1061861253_1061861270 23 Left 1061861253 9:133469743-133469765 CCATCGGGCAGGTGCCTGGTCGG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1061861270 9:133469789-133469811 TTGGCAGAAGCGGGCGGGTGTGG 0: 1
1: 0
2: 1
3: 21
4: 223
1061861253_1061861258 -6 Left 1061861253 9:133469743-133469765 CCATCGGGCAGGTGCCTGGTCGG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1061861258 9:133469760-133469782 GGTCGGGCCTGGCTTAGCCCAGG 0: 1
1: 0
2: 0
3: 12
4: 159
1061861253_1061861267 14 Left 1061861253 9:133469743-133469765 CCATCGGGCAGGTGCCTGGTCGG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1061861267 9:133469780-133469802 AGGTGGGGTTTGGCAGAAGCGGG 0: 1
1: 0
2: 0
3: 31
4: 366
1061861253_1061861269 18 Left 1061861253 9:133469743-133469765 CCATCGGGCAGGTGCCTGGTCGG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1061861269 9:133469784-133469806 GGGGTTTGGCAGAAGCGGGCGGG 0: 1
1: 0
2: 2
3: 15
4: 211
1061861253_1061861268 17 Left 1061861253 9:133469743-133469765 CCATCGGGCAGGTGCCTGGTCGG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1061861268 9:133469783-133469805 TGGGGTTTGGCAGAAGCGGGCGG 0: 1
1: 0
2: 1
3: 27
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061861253 Original CRISPR CCGACCAGGCACCTGCCCGA TGG (reversed) Exonic