ID: 1061863420

View in Genome Browser
Species Human (GRCh38)
Location 9:133479209-133479231
Sequence CCGAGCATCAGGACAGCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061863420_1061863426 -1 Left 1061863420 9:133479209-133479231 CCGCAGGCTGTCCTGATGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1061863426 9:133479231-133479253 GATGCGGACCCGGCTTCCCCGGG 0: 1
1: 0
2: 1
3: 5
4: 82
1061863420_1061863430 8 Left 1061863420 9:133479209-133479231 CCGCAGGCTGTCCTGATGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1061863430 9:133479240-133479262 CCGGCTTCCCCGGGCGCGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 186
1061863420_1061863435 29 Left 1061863420 9:133479209-133479231 CCGCAGGCTGTCCTGATGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1061863420_1061863427 4 Left 1061863420 9:133479209-133479231 CCGCAGGCTGTCCTGATGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1061863427 9:133479236-133479258 GGACCCGGCTTCCCCGGGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 203
1061863420_1061863425 -2 Left 1061863420 9:133479209-133479231 CCGCAGGCTGTCCTGATGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1061863425 9:133479230-133479252 GGATGCGGACCCGGCTTCCCCGG 0: 1
1: 0
2: 1
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061863420 Original CRISPR CCGAGCATCAGGACAGCCTG CGG (reversed) Intergenic