ID: 1061863423

View in Genome Browser
Species Human (GRCh38)
Location 9:133479220-133479242
Sequence CGGGTCCGCATCCGAGCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 22
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 21}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061863423_1061863430 -3 Left 1061863423 9:133479220-133479242 CCTGATGCTCGGATGCGGACCCG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1061863430 9:133479240-133479262 CCGGCTTCCCCGGGCGCGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 186
1061863423_1061863427 -7 Left 1061863423 9:133479220-133479242 CCTGATGCTCGGATGCGGACCCG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1061863427 9:133479236-133479258 GGACCCGGCTTCCCCGGGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 203
1061863423_1061863435 18 Left 1061863423 9:133479220-133479242 CCTGATGCTCGGATGCGGACCCG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG 0: 1
1: 0
2: 0
3: 5
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061863423 Original CRISPR CGGGTCCGCATCCGAGCATC AGG (reversed) Intergenic