ID: 1061863427

View in Genome Browser
Species Human (GRCh38)
Location 9:133479236-133479258
Sequence GGACCCGGCTTCCCCGGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061863420_1061863427 4 Left 1061863420 9:133479209-133479231 CCGCAGGCTGTCCTGATGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1061863427 9:133479236-133479258 GGACCCGGCTTCCCCGGGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 203
1061863419_1061863427 16 Left 1061863419 9:133479197-133479219 CCAATGGGGCGGCCGCAGGCTGT 0: 1
1: 0
2: 1
3: 8
4: 78
Right 1061863427 9:133479236-133479258 GGACCCGGCTTCCCCGGGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 203
1061863417_1061863427 20 Left 1061863417 9:133479193-133479215 CCGGCCAATGGGGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1061863427 9:133479236-133479258 GGACCCGGCTTCCCCGGGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 203
1061863423_1061863427 -7 Left 1061863423 9:133479220-133479242 CCTGATGCTCGGATGCGGACCCG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1061863427 9:133479236-133479258 GGACCCGGCTTCCCCGGGCGCGG 0: 1
1: 0
2: 0
3: 16
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061863427 Original CRISPR GGACCCGGCTTCCCCGGGCG CGG Intergenic