ID: 1061863428

View in Genome Browser
Species Human (GRCh38)
Location 9:133479239-133479261
Sequence CGGCCGCGCCCGGGGAAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 227}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061863428_1061863435 -1 Left 1061863428 9:133479239-133479261 CCCGGCTTCCCCGGGCGCGGCCG 0: 1
1: 0
2: 5
3: 26
4: 227
Right 1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1061863428_1061863442 20 Left 1061863428 9:133479239-133479261 CCCGGCTTCCCCGGGCGCGGCCG 0: 1
1: 0
2: 5
3: 26
4: 227
Right 1061863442 9:133479282-133479304 GGTCACGCCCCAAGACAGGATGG 0: 1
1: 0
2: 0
3: 7
4: 81
1061863428_1061863444 22 Left 1061863428 9:133479239-133479261 CCCGGCTTCCCCGGGCGCGGCCG 0: 1
1: 0
2: 5
3: 26
4: 227
Right 1061863444 9:133479284-133479306 TCACGCCCCAAGACAGGATGGGG 0: 1
1: 0
2: 0
3: 7
4: 85
1061863428_1061863443 21 Left 1061863428 9:133479239-133479261 CCCGGCTTCCCCGGGCGCGGCCG 0: 1
1: 0
2: 5
3: 26
4: 227
Right 1061863443 9:133479283-133479305 GTCACGCCCCAAGACAGGATGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1061863428_1061863441 16 Left 1061863428 9:133479239-133479261 CCCGGCTTCCCCGGGCGCGGCCG 0: 1
1: 0
2: 5
3: 26
4: 227
Right 1061863441 9:133479278-133479300 CGAAGGTCACGCCCCAAGACAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1061863428_1061863449 30 Left 1061863428 9:133479239-133479261 CCCGGCTTCCCCGGGCGCGGCCG 0: 1
1: 0
2: 5
3: 26
4: 227
Right 1061863449 9:133479292-133479314 CAAGACAGGATGGGGGTCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 221
1061863428_1061863445 23 Left 1061863428 9:133479239-133479261 CCCGGCTTCCCCGGGCGCGGCCG 0: 1
1: 0
2: 5
3: 26
4: 227
Right 1061863445 9:133479285-133479307 CACGCCCCAAGACAGGATGGGGG 0: 1
1: 0
2: 0
3: 9
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061863428 Original CRISPR CGGCCGCGCCCGGGGAAGCC GGG (reversed) Intergenic