ID: 1061863430

View in Genome Browser
Species Human (GRCh38)
Location 9:133479240-133479262
Sequence CCGGCTTCCCCGGGCGCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061863419_1061863430 20 Left 1061863419 9:133479197-133479219 CCAATGGGGCGGCCGCAGGCTGT 0: 1
1: 0
2: 1
3: 8
4: 78
Right 1061863430 9:133479240-133479262 CCGGCTTCCCCGGGCGCGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 186
1061863423_1061863430 -3 Left 1061863423 9:133479220-133479242 CCTGATGCTCGGATGCGGACCCG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1061863430 9:133479240-133479262 CCGGCTTCCCCGGGCGCGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 186
1061863417_1061863430 24 Left 1061863417 9:133479193-133479215 CCGGCCAATGGGGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1061863430 9:133479240-133479262 CCGGCTTCCCCGGGCGCGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 186
1061863420_1061863430 8 Left 1061863420 9:133479209-133479231 CCGCAGGCTGTCCTGATGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1061863430 9:133479240-133479262 CCGGCTTCCCCGGGCGCGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061863430 Original CRISPR CCGGCTTCCCCGGGCGCGGC CGG Intergenic