ID: 1061863432

View in Genome Browser
Species Human (GRCh38)
Location 9:133479248-133479270
Sequence ACGCGGTGCCGGCCGCGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 139}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061863432_1061863441 7 Left 1061863432 9:133479248-133479270 CCCGGGCGCGGCCGGCACCGCGT 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1061863441 9:133479278-133479300 CGAAGGTCACGCCCCAAGACAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1061863432_1061863450 22 Left 1061863432 9:133479248-133479270 CCCGGGCGCGGCCGGCACCGCGT 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1061863450 9:133479293-133479315 AAGACAGGATGGGGGTCCCAGGG 0: 1
1: 0
2: 1
3: 21
4: 226
1061863432_1061863449 21 Left 1061863432 9:133479248-133479270 CCCGGGCGCGGCCGGCACCGCGT 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1061863449 9:133479292-133479314 CAAGACAGGATGGGGGTCCCAGG 0: 1
1: 0
2: 2
3: 19
4: 221
1061863432_1061863451 25 Left 1061863432 9:133479248-133479270 CCCGGGCGCGGCCGGCACCGCGT 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1061863451 9:133479296-133479318 ACAGGATGGGGGTCCCAGGGCGG 0: 1
1: 0
2: 1
3: 40
4: 343
1061863432_1061863445 14 Left 1061863432 9:133479248-133479270 CCCGGGCGCGGCCGGCACCGCGT 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1061863445 9:133479285-133479307 CACGCCCCAAGACAGGATGGGGG 0: 1
1: 0
2: 0
3: 9
4: 116
1061863432_1061863444 13 Left 1061863432 9:133479248-133479270 CCCGGGCGCGGCCGGCACCGCGT 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1061863444 9:133479284-133479306 TCACGCCCCAAGACAGGATGGGG 0: 1
1: 0
2: 0
3: 7
4: 85
1061863432_1061863443 12 Left 1061863432 9:133479248-133479270 CCCGGGCGCGGCCGGCACCGCGT 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1061863443 9:133479283-133479305 GTCACGCCCCAAGACAGGATGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1061863432_1061863435 -10 Left 1061863432 9:133479248-133479270 CCCGGGCGCGGCCGGCACCGCGT 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1061863432_1061863442 11 Left 1061863432 9:133479248-133479270 CCCGGGCGCGGCCGGCACCGCGT 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1061863442 9:133479282-133479304 GGTCACGCCCCAAGACAGGATGG 0: 1
1: 0
2: 0
3: 7
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061863432 Original CRISPR ACGCGGTGCCGGCCGCGCCC GGG (reversed) Intergenic