ID: 1061863435

View in Genome Browser
Species Human (GRCh38)
Location 9:133479261-133479283
Sequence GGCACCGCGTGCGCCCCCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 47}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061863431_1061863435 -9 Left 1061863431 9:133479247-133479269 CCCCGGGCGCGGCCGGCACCGCG 0: 1
1: 0
2: 1
3: 20
4: 272
Right 1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1061863428_1061863435 -1 Left 1061863428 9:133479239-133479261 CCCGGCTTCCCCGGGCGCGGCCG 0: 1
1: 0
2: 5
3: 26
4: 227
Right 1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1061863432_1061863435 -10 Left 1061863432 9:133479248-133479270 CCCGGGCGCGGCCGGCACCGCGT 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1061863420_1061863435 29 Left 1061863420 9:133479209-133479231 CCGCAGGCTGTCCTGATGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1061863429_1061863435 -2 Left 1061863429 9:133479240-133479262 CCGGCTTCCCCGGGCGCGGCCGG 0: 1
1: 0
2: 1
3: 19
4: 222
Right 1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1061863423_1061863435 18 Left 1061863423 9:133479220-133479242 CCTGATGCTCGGATGCGGACCCG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG 0: 1
1: 0
2: 0
3: 5
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061863435 Original CRISPR GGCACCGCGTGCGCCCCCGA AGG Intergenic
901242863 1:7704951-7704973 CGCCCCGCGCGCGCCCCCGCCGG - Intronic
901641440 1:10694933-10694955 GGCCCCGCGAGCGCGACCGACGG + Intronic
903078104 1:20787330-20787352 GGCCCCGCGCGCGCCCCCGCCGG + Intergenic
904236708 1:29121656-29121678 AGCGCCGCGAACGCCCCCGACGG + Exonic
1067841063 10:49679804-49679826 CTCGCCGCGTGCGCCCCTGAGGG + Intronic
1072891562 10:99329565-99329587 GGCACCCTGCGCGCCGCCGAAGG + Exonic
1073414267 10:103368212-103368234 GGCACCGGGGCCGCCCCCGCCGG - Exonic
1076805965 10:132858861-132858883 GGCAACGGGGGCTCCCCCGACGG + Intronic
1084166867 11:67379198-67379220 GGCACCACTGGGGCCCCCGAGGG + Intronic
1093633497 12:21437736-21437758 GGCAGCGCGCCCTCCCCCGACGG + Exonic
1096482411 12:51951565-51951587 GCCGCCGCGCGCGCCCCCGAAGG - Intergenic
1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG + Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1110860124 13:80339025-80339047 GGGGCCGCGGGCGCCTCCGAAGG + Exonic
1113852597 13:113426332-113426354 GGCACCGCGGGAGCCACAGAGGG + Intronic
1122975442 14:105168918-105168940 GGCCCGGCGCGCGCCCCCCAGGG + Intergenic
1123119023 14:105908509-105908531 TGCACAGGGTGCTCCCCCGAAGG + Intergenic
1125999250 15:44194564-44194586 GCCAAAGCCTGCGCCCCCGACGG + Intronic
1131108625 15:89750733-89750755 GGCACAGCGGGCAGCCCCGAGGG + Exonic
1131248645 15:90817085-90817107 GGCACAGCCTGCGACCCTGAGGG - Intergenic
1132686259 16:1163366-1163388 GGCACCTCGTGCTCCCGGGAGGG + Intronic
1151246181 17:72796645-72796667 GGCACAGCGTGCCCCCTCCAGGG - Intronic
1151570872 17:74924674-74924696 GGCGCCGCGTGCGGGCCCCAGGG + Exonic
1160684474 19:427096-427118 GGCACCGGGTGGGCACTCGATGG + Intronic
1160763703 19:797951-797973 GGAAAGGCGCGCGCCCCCGATGG - Intronic
1166415649 19:42593256-42593278 GGCACCCCGTGCCCTCCCCATGG - Intronic
1167129182 19:47573161-47573183 GGCTGCGCGTGCGCCCCGGGCGG - Intergenic
928303719 2:30147928-30147950 GGGCCCGCGAGCGCCCCCGCCGG - Intronic
932772121 2:74506289-74506311 GCCACCGCGCCCGGCCCCGAAGG - Intronic
934846391 2:97663783-97663805 GCCGCCGCGTGCGCCCCCGGGGG + Intronic
937283826 2:120737401-120737423 GGGACCTCGAGCCCCCCCGAGGG + Intronic
946308824 2:218871649-218871671 GGCCCCGCGGGCTCCCCGGAAGG + Exonic
1173576560 20:44116006-44116028 GGCACCGCCTGCGCCGTCGCGGG - Exonic
1175162702 20:57020807-57020829 GGCAAGGCGGGTGCCCCCGAGGG - Intergenic
1178555774 21:33588744-33588766 GGCCCCGCCTCCGCCCCCGCCGG + Intronic
1180014830 21:45075029-45075051 GGCCCCGCGTCCCCTCCCGAGGG + Intronic
1185426621 22:50775390-50775412 GTCCCAGCGTGCGCCCCCTAGGG + Intronic
951544476 3:23810788-23810810 CACCCCGCGCGCGCCCCCGACGG - Intronic
1005916681 6:30358056-30358078 GGCAGCGCGTGGGGTCCCGACGG - Intergenic
1015999653 6:139029519-139029541 GGCACCGCTGGCGCCCGGGAAGG - Intronic
1018724084 6:166597253-166597275 GGCACCCCGTGAGGCCCCAAAGG + Intronic
1023382713 7:39624000-39624022 GGCACCGCGTTCGCCGCTGTGGG + Intronic
1030033359 7:105388584-105388606 GCGGCCGCGGGCGCCCCCGACGG + Intronic
1033333780 7:140435533-140435555 GGCACCGCGAGGGCCCGCGAGGG - Intergenic
1033705921 7:143885048-143885070 AGCCCCGCGTGCGCCCCCCTCGG + Intronic
1049107827 8:140624674-140624696 GGCACCGTGTGCTCCCCGGCTGG + Intronic
1053482193 9:38424069-38424091 GGCACCGTCTGCGGCTCCGACGG - Exonic
1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG + Intronic
1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG + Intergenic
1061991753 9:134163219-134163241 GGCACCGCGTCCTTCCCCGGAGG + Intergenic
1192147818 X:68693724-68693746 GGCCCCGCGTGTGTCCCGGACGG + Intronic
1197335568 X:125205792-125205814 AGCACCGCGTGTGCTCCCAAGGG + Intergenic
1200239491 X:154486390-154486412 GCCCACGCGTCCGCCCCCGAGGG + Intronic