ID: 1061863435

View in Genome Browser
Species Human (GRCh38)
Location 9:133479261-133479283
Sequence GGCACCGCGTGCGCCCCCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 47}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061863432_1061863435 -10 Left 1061863432 9:133479248-133479270 CCCGGGCGCGGCCGGCACCGCGT 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1061863420_1061863435 29 Left 1061863420 9:133479209-133479231 CCGCAGGCTGTCCTGATGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1061863423_1061863435 18 Left 1061863423 9:133479220-133479242 CCTGATGCTCGGATGCGGACCCG 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1061863431_1061863435 -9 Left 1061863431 9:133479247-133479269 CCCCGGGCGCGGCCGGCACCGCG 0: 1
1: 0
2: 1
3: 20
4: 272
Right 1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1061863428_1061863435 -1 Left 1061863428 9:133479239-133479261 CCCGGCTTCCCCGGGCGCGGCCG 0: 1
1: 0
2: 5
3: 26
4: 227
Right 1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1061863429_1061863435 -2 Left 1061863429 9:133479240-133479262 CCGGCTTCCCCGGGCGCGGCCGG 0: 1
1: 0
2: 1
3: 19
4: 222
Right 1061863435 9:133479261-133479283 GGCACCGCGTGCGCCCCCGAAGG 0: 1
1: 0
2: 0
3: 5
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061863435 Original CRISPR GGCACCGCGTGCGCCCCCGA AGG Intergenic