ID: 1061865270

View in Genome Browser
Species Human (GRCh38)
Location 9:133488892-133488914
Sequence TGCCTCGGGCAGCCTCTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061865270_1061865277 21 Left 1061865270 9:133488892-133488914 CCCGTCAGAGGCTGCCCGAGGCA No data
Right 1061865277 9:133488936-133488958 TCCTCCCAAGTGCTGAGATCAGG No data
1061865270_1061865275 -7 Left 1061865270 9:133488892-133488914 CCCGTCAGAGGCTGCCCGAGGCA No data
Right 1061865275 9:133488908-133488930 CGAGGCAGAGGCAGAACCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061865270 Original CRISPR TGCCTCGGGCAGCCTCTGAC GGG (reversed) Intergenic
No off target data available for this crispr