ID: 1061866618

View in Genome Browser
Species Human (GRCh38)
Location 9:133494678-133494700
Sequence CCTTATCTGCAGGAGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061866618_1061866628 5 Left 1061866618 9:133494678-133494700 CCCGCCTCCTCCTGCAGATAAGG No data
Right 1061866628 9:133494706-133494728 GGTTTGCTTCTTGCGCATGGAGG No data
1061866618_1061866627 2 Left 1061866618 9:133494678-133494700 CCCGCCTCCTCCTGCAGATAAGG No data
Right 1061866627 9:133494703-133494725 TGGGGTTTGCTTCTTGCGCATGG No data
1061866618_1061866630 10 Left 1061866618 9:133494678-133494700 CCCGCCTCCTCCTGCAGATAAGG No data
Right 1061866630 9:133494711-133494733 GCTTCTTGCGCATGGAGGATGGG No data
1061866618_1061866631 16 Left 1061866618 9:133494678-133494700 CCCGCCTCCTCCTGCAGATAAGG No data
Right 1061866631 9:133494717-133494739 TGCGCATGGAGGATGGGTACAGG No data
1061866618_1061866629 9 Left 1061866618 9:133494678-133494700 CCCGCCTCCTCCTGCAGATAAGG No data
Right 1061866629 9:133494710-133494732 TGCTTCTTGCGCATGGAGGATGG No data
1061866618_1061866632 17 Left 1061866618 9:133494678-133494700 CCCGCCTCCTCCTGCAGATAAGG No data
Right 1061866632 9:133494718-133494740 GCGCATGGAGGATGGGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061866618 Original CRISPR CCTTATCTGCAGGAGGAGGC GGG (reversed) Intergenic
No off target data available for this crispr