ID: 1061866629

View in Genome Browser
Species Human (GRCh38)
Location 9:133494710-133494732
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061866624_1061866629 2 Left 1061866624 9:133494685-133494707 CCTCCTGCAGATAAGGAGTGGGG No data
Right 1061866629 9:133494710-133494732 TGCTTCTTGCGCATGGAGGATGG No data
1061866618_1061866629 9 Left 1061866618 9:133494678-133494700 CCCGCCTCCTCCTGCAGATAAGG No data
Right 1061866629 9:133494710-133494732 TGCTTCTTGCGCATGGAGGATGG No data
1061866617_1061866629 26 Left 1061866617 9:133494661-133494683 CCATATCGACAGAGAAGCCCGCC No data
Right 1061866629 9:133494710-133494732 TGCTTCTTGCGCATGGAGGATGG No data
1061866620_1061866629 8 Left 1061866620 9:133494679-133494701 CCGCCTCCTCCTGCAGATAAGGA No data
Right 1061866629 9:133494710-133494732 TGCTTCTTGCGCATGGAGGATGG No data
1061866616_1061866629 27 Left 1061866616 9:133494660-133494682 CCCATATCGACAGAGAAGCCCGC No data
Right 1061866629 9:133494710-133494732 TGCTTCTTGCGCATGGAGGATGG No data
1061866621_1061866629 5 Left 1061866621 9:133494682-133494704 CCTCCTCCTGCAGATAAGGAGTG No data
Right 1061866629 9:133494710-133494732 TGCTTCTTGCGCATGGAGGATGG No data
1061866626_1061866629 -1 Left 1061866626 9:133494688-133494710 CCTGCAGATAAGGAGTGGGGTTT No data
Right 1061866629 9:133494710-133494732 TGCTTCTTGCGCATGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061866629 Original CRISPR TGCTTCTTGCGCATGGAGGA TGG Intergenic
No off target data available for this crispr