ID: 1061866710

View in Genome Browser
Species Human (GRCh38)
Location 9:133495044-133495066
Sequence TCCCCAGGACCCTTCCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061866707_1061866710 -9 Left 1061866707 9:133495030-133495052 CCTCCAGCTGTGTCTCCCCAGGA No data
Right 1061866710 9:133495044-133495066 TCCCCAGGACCCTTCCATGGAGG No data
1061866704_1061866710 15 Left 1061866704 9:133495006-133495028 CCACATGAACGCAGCTTCCAGAC No data
Right 1061866710 9:133495044-133495066 TCCCCAGGACCCTTCCATGGAGG No data
1061866705_1061866710 -2 Left 1061866705 9:133495023-133495045 CCAGACACCTCCAGCTGTGTCTC No data
Right 1061866710 9:133495044-133495066 TCCCCAGGACCCTTCCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061866710 Original CRISPR TCCCCAGGACCCTTCCATGG AGG Intergenic
No off target data available for this crispr