ID: 1061868324

View in Genome Browser
Species Human (GRCh38)
Location 9:133506797-133506819
Sequence ATTTGTTAAGTGCCTGCCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061868322_1061868324 2 Left 1061868322 9:133506772-133506794 CCACTCATCCATTCATTTGACAA No data
Right 1061868324 9:133506797-133506819 ATTTGTTAAGTGCCTGCCTACGG No data
1061868319_1061868324 29 Left 1061868319 9:133506745-133506767 CCCTTGCCAAGACAGATATGGAA No data
Right 1061868324 9:133506797-133506819 ATTTGTTAAGTGCCTGCCTACGG No data
1061868321_1061868324 23 Left 1061868321 9:133506751-133506773 CCAAGACAGATATGGAAAAATCC No data
Right 1061868324 9:133506797-133506819 ATTTGTTAAGTGCCTGCCTACGG No data
1061868323_1061868324 -6 Left 1061868323 9:133506780-133506802 CCATTCATTTGACAAATATTTGT No data
Right 1061868324 9:133506797-133506819 ATTTGTTAAGTGCCTGCCTACGG No data
1061868320_1061868324 28 Left 1061868320 9:133506746-133506768 CCTTGCCAAGACAGATATGGAAA No data
Right 1061868324 9:133506797-133506819 ATTTGTTAAGTGCCTGCCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061868324 Original CRISPR ATTTGTTAAGTGCCTGCCTA CGG Intergenic
No off target data available for this crispr