ID: 1061869988

View in Genome Browser
Species Human (GRCh38)
Location 9:133515399-133515421
Sequence ACCAGGGCTGTGCCCACGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 1, 2: 1, 3: 30, 4: 229}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061869988_1061869996 14 Left 1061869988 9:133515399-133515421 CCCAGCGTGGGCACAGCCCTGGT 0: 1
1: 1
2: 1
3: 30
4: 229
Right 1061869996 9:133515436-133515458 GAGCCATGCCGAGTGGGCTCTGG 0: 1
1: 0
2: 1
3: 9
4: 130
1061869988_1061870001 22 Left 1061869988 9:133515399-133515421 CCCAGCGTGGGCACAGCCCTGGT 0: 1
1: 1
2: 1
3: 30
4: 229
Right 1061870001 9:133515444-133515466 CCGAGTGGGCTCTGGGGCACAGG 0: 1
1: 0
2: 2
3: 25
4: 258
1061869988_1061869995 8 Left 1061869988 9:133515399-133515421 CCCAGCGTGGGCACAGCCCTGGT 0: 1
1: 1
2: 1
3: 30
4: 229
Right 1061869995 9:133515430-133515452 TGAGCAGAGCCATGCCGAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 109
1061869988_1061869997 15 Left 1061869988 9:133515399-133515421 CCCAGCGTGGGCACAGCCCTGGT 0: 1
1: 1
2: 1
3: 30
4: 229
Right 1061869997 9:133515437-133515459 AGCCATGCCGAGTGGGCTCTGGG 0: 1
1: 0
2: 0
3: 8
4: 121
1061869988_1061869994 7 Left 1061869988 9:133515399-133515421 CCCAGCGTGGGCACAGCCCTGGT 0: 1
1: 1
2: 1
3: 30
4: 229
Right 1061869994 9:133515429-133515451 CTGAGCAGAGCCATGCCGAGTGG 0: 1
1: 0
2: 0
3: 9
4: 157
1061869988_1061869998 16 Left 1061869988 9:133515399-133515421 CCCAGCGTGGGCACAGCCCTGGT 0: 1
1: 1
2: 1
3: 30
4: 229
Right 1061869998 9:133515438-133515460 GCCATGCCGAGTGGGCTCTGGGG 0: 1
1: 0
2: 2
3: 12
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061869988 Original CRISPR ACCAGGGCTGTGCCCACGCT GGG (reversed) Intronic
900195064 1:1371826-1371848 CCCAGGGCTGTGCCTGAGCTGGG + Intergenic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
900401986 1:2476409-2476431 CACAGGGCTGTGCCCAGGCCCGG - Exonic
900435374 1:2628569-2628591 ACCAGGGCTGTGCCTGCGGAGGG + Intronic
900946829 1:5835500-5835522 CCCAGGCCTGTGCCCAGCCTGGG + Intergenic
902197829 1:14810824-14810846 ACCTGGCCTGTCCCCACCCTGGG - Intronic
902219412 1:14955428-14955450 ACCAGGGCTGTCTCCACTCCTGG + Intronic
902619913 1:17644740-17644762 AGCAGGGCTGGGCCCGCGGTGGG + Intronic
903214908 1:21838590-21838612 GCCAGGGCTGTGCCAAAGGTGGG + Intronic
904316499 1:29669594-29669616 CCCAGGGCTGTTCCCACACTAGG - Intergenic
905417262 1:37812588-37812610 GCCAGGGCTGTGCTCATGTTGGG - Exonic
905522121 1:38608340-38608362 ACCAGGGCTGTGCTCACGCTGGG + Intergenic
906076383 1:43055227-43055249 AGCAAGGCTGTGCCTAAGCTTGG + Intergenic
906700958 1:47857641-47857663 CCCAGGGCCCTGCCCAGGCTGGG + Intronic
907229618 1:52984230-52984252 TCCAGGGCTGTGCTCAACCTTGG + Intronic
908121444 1:60989956-60989978 CCCAGGGCTGTGCTCAAGCTGGG - Intronic
912655917 1:111486277-111486299 AGCAGGGATGTGGCCACCCTTGG - Intronic
912861773 1:113219839-113219861 ACCAGGCCTGTGGTCACTCTGGG - Intergenic
913522591 1:119659876-119659898 ACCAGCTCTGTGTCCACTCTGGG - Intronic
913957556 1:143319000-143319022 ACGAGGGCTGGGCCCAGGCTGGG + Intergenic
914051867 1:144144364-144144386 ACGAGGGCTGGGCCCAGGCTGGG + Intergenic
914127330 1:144822177-144822199 ACGAGGGCTGGGCCCAGGCTGGG - Intergenic
920850286 1:209623791-209623813 ACCACGGCAGTGCCCATGCCCGG + Intronic
923686135 1:236155022-236155044 ACAAGGGCTGTGGCCACACAAGG - Intronic
924447789 1:244149956-244149978 ATCAAAGCTGTGCCCAGGCTAGG - Intergenic
1067830355 10:49608272-49608294 GCCAGGCCTGTGCCCACATTGGG + Intergenic
1070705686 10:78636238-78636260 ACCAAGTCTGTGTCCAAGCTTGG - Intergenic
1070780873 10:79136856-79136878 ACCAGGGCTGTGCCCAGGAGAGG - Intronic
1072265939 10:93728094-93728116 TCCAGGACTGTGCCCACCCTTGG + Intergenic
1075655097 10:124156102-124156124 ACCAGAGCTGTGCCCTCGCAGGG - Intergenic
1076474878 10:130744885-130744907 ACAACGGCTGTGTCCACCCTCGG + Intergenic
1076675316 10:132144484-132144506 GGCAGGGCTGAGCACACGCTAGG + Intronic
1077327765 11:1971095-1971117 AGCAGGGCTGTGGCCAGGCCGGG - Intronic
1077401814 11:2362556-2362578 ACCAGTGCTGTGGTCCCGCTGGG - Intergenic
1077532429 11:3103513-3103535 GCCAGGGCTGCTCCCACGCTGGG + Intronic
1080520977 11:33067667-33067689 ACCAGCTCTGTGCCCACCCCTGG - Intronic
1081834815 11:46144756-46144778 TCCAGGGCTGTGCCCCCAATGGG - Intergenic
1083172101 11:60929130-60929152 TCCAGGGCTGTGCCCATGGTGGG - Intronic
1083408047 11:62472193-62472215 GCCGGGGCTGGGCCCACTCTAGG - Intronic
1084001153 11:66296013-66296035 ACCGGGGCTGAGGCCATGCTGGG + Exonic
1084192826 11:67506604-67506626 GCCAGGCCTGTGCCCCTGCTGGG + Exonic
1085931581 11:81089553-81089575 ACCAAGTCTGTGTCCAGGCTGGG - Intergenic
1086060945 11:82699209-82699231 ACCAGGTCTGTTACCACACTTGG - Intergenic
1088640758 11:111871078-111871100 ACAGAGGCTGTGCCCACTCTAGG + Intronic
1090979209 11:131702186-131702208 ACCAGGGATCGGCCCACACTTGG + Intronic
1091224043 11:133947028-133947050 CCCAGGGCTGTCCCCACGTTGGG + Intronic
1202810747 11_KI270721v1_random:26275-26297 AGCAGGGCTGTGGCCAGGCCAGG - Intergenic
1091760933 12:3086876-3086898 ACCCTGGCTGTGCGCACACTTGG + Intronic
1092756923 12:11772420-11772442 ATCAGGTCTGTGCCCATGCCTGG + Intronic
1094385485 12:29888953-29888975 ACCAGCGCTGTGCGCAGCCTGGG + Intergenic
1096474682 12:51901093-51901115 TCCAGGTCTGTGCCCAGACTGGG + Intergenic
1096536449 12:52278151-52278173 ACAAGGGCTGTCACCAGGCTAGG + Intronic
1105250844 13:18697704-18697726 CACAGGGCTGGGCCCACCCTGGG + Intergenic
1105943720 13:25172143-25172165 TCCAGAGCTGAGCACACGCTAGG + Exonic
1106252108 13:27989977-27989999 ACAAGAGCTGTGCCTACGGTAGG + Intergenic
1109218579 13:59617355-59617377 AACAGCCCTGTGCCTACGCTCGG + Intergenic
1110052713 13:70924141-70924163 ACCAGAGCTGGGCCCAGGCCAGG + Intergenic
1112031704 13:95462522-95462544 GATAGGGCTGTGCCCACCCTAGG - Intronic
1113664717 13:112133279-112133301 ACTTGGGCTGTGCACAAGCTGGG - Intergenic
1113768347 13:112894332-112894354 CCCAGGGCTGCGCCGACACTGGG - Intergenic
1115477918 14:33834105-33834127 ACCAGGCCTGTGCCATGGCTGGG + Intergenic
1116773434 14:49152908-49152930 AACAGGACTGTGCTCAGGCTGGG + Intergenic
1117061217 14:51965871-51965893 ACCAGGGCTGGGACCAGGGTGGG + Intronic
1118346921 14:64947586-64947608 ACCAGAGCTTTGCCCTTGCTTGG - Exonic
1118492662 14:66276733-66276755 ACCAGTGCTGTTCCCAGACTTGG + Intergenic
1118868254 14:69719917-69719939 GCCAGGGCAGCCCCCACGCTGGG - Intergenic
1119995419 14:79248350-79248372 TCCAGGACTTTGCCCATGCTGGG + Intronic
1122010711 14:98744532-98744554 AACAGGGCTCTTGCCACGCTAGG + Intergenic
1122133371 14:99618951-99618973 CCCAGAGCTGTGCCCAGGCCTGG - Intergenic
1122630951 14:103107566-103107588 GGCAGGGCTGTGCCCAGGATTGG + Intronic
1122651786 14:103230443-103230465 GCCAGGTCTGTGCCCACAATGGG + Intergenic
1122689064 14:103522983-103523005 ACCCGAGCTGTCCCCTCGCTGGG + Exonic
1122789176 14:104177163-104177185 CCCCGGGCTGTACCCAAGCTGGG + Exonic
1122871601 14:104641289-104641311 ACCAGGGCTGTGCTGGGGCTGGG + Intergenic
1123044239 14:105503568-105503590 ACCAGGGCTGTGCTCTCACCAGG + Intergenic
1202930828 14_KI270725v1_random:31090-31112 ATGAGGGCTGGGCCCAGGCTGGG - Intergenic
1123421531 15:20140322-20140344 ATGAGGGCTGGGCCCAGGCTGGG + Intergenic
1123421607 15:20140642-20140664 AGCAGGGCTGGGCCAACGTTGGG + Intergenic
1123443448 15:20305874-20305896 AGCAGGGCTGGGCCAACGTTGGG - Intergenic
1123443524 15:20306193-20306215 ACAAGGGCTGGGCCCAGGCTGGG - Intergenic
1123530757 15:21146862-21146884 ATGAGGGCTGGGCCCAGGCTGGG + Intergenic
1123530833 15:21147182-21147204 AGCAGGGCTGGGCCAACGTTGGG + Intergenic
1123923899 15:25090064-25090086 ACAAGGGCTGTGTCAACACTTGG + Intergenic
1127700728 15:61497728-61497750 ACAAGTTCTGTGCCCAAGCTTGG + Intergenic
1129355419 15:74987616-74987638 ACCAGGGCCAGGCCCAGGCTGGG + Intronic
1129454654 15:75670267-75670289 GCCACTGCTGTGCCCATGCTGGG - Intergenic
1129617985 15:77114936-77114958 ATCAGGGCTTTTCCCATGCTGGG + Exonic
1129718603 15:77865761-77865783 ACCAGGGCTGGGCACACACCAGG + Intergenic
1129744400 15:78008005-78008027 TCCAGGTCTGTGCCCCCGCCTGG - Intronic
1129874311 15:78962850-78962872 ACAAGGTCTGTACCCAAGCTGGG - Intronic
1130677479 15:85966232-85966254 ACCAAGGCTGTGACTACGCAGGG - Intergenic
1130933532 15:88449663-88449685 TCCAGGCCTGTGCTCACGCATGG - Intergenic
1131383164 15:91981138-91981160 AGCAGGGCAGTGGCCAGGCTGGG + Intronic
1132659381 16:1054690-1054712 ACCAGGGCTGCTCACACGCCAGG - Intergenic
1132843831 16:1990884-1990906 AGGAGGGCGGTGCCCACGGTGGG + Intronic
1133174590 16:4004475-4004497 ACCAGGGCAGCGCCCACGAAGGG - Intronic
1133193807 16:4154064-4154086 CCCAGGCCTGTGCCAACGCTTGG + Intergenic
1133232967 16:4374965-4374987 ACCAGGGCTGGGCCCTCACACGG - Intronic
1135165464 16:20135192-20135214 ACACGGGCTGTGCCCCCGCCAGG - Intergenic
1136722690 16:32337693-32337715 GCAAGGGCTGGGCCCAGGCTGGG + Intergenic
1136722767 16:32338013-32338035 AGCAGGGCTGGGCCAACGTTGGG + Intergenic
1136841012 16:33543692-33543714 GCAAGGGCTGGGCCCAGGCTGGG + Intergenic
1136841089 16:33544012-33544034 AGCAGGGCTGGGCCAACGTTGGG + Intergenic
1139346138 16:66305129-66305151 GCCAGGGCTCTGCCCTGGCTGGG + Intergenic
1139505915 16:67398035-67398057 CCTCTGGCTGTGCCCACGCTTGG + Intronic
1139561338 16:67744286-67744308 ACCAAGGCTGTGGCCATTCTTGG + Exonic
1140287306 16:73616096-73616118 ACAAGGGCTGTCACCACTCTGGG + Intergenic
1141031463 16:80592508-80592530 ACCAGGAGTGTGCCTACGCTGGG - Intergenic
1141882809 16:86871097-86871119 GCCATGGCTGTGCCCACCCAGGG + Intergenic
1141965387 16:87438778-87438800 ACCGGGGCAGTGCCGACGGTGGG - Intronic
1142122438 16:88393533-88393555 TCCTGGGCTCTGCCCACCCTGGG - Intergenic
1203003664 16_KI270728v1_random:179751-179773 AGCAGGGCTGGGCCAACGTTGGG - Intergenic
1203003741 16_KI270728v1_random:180071-180093 GCAAGGGCTGGGCCCAGGCTGGG - Intergenic
1203135272 16_KI270728v1_random:1716158-1716180 AGCAGGGCTGGGCCAACGTTGGG - Intergenic
1203135349 16_KI270728v1_random:1716478-1716500 GCAAGGGCTGGGCCCAGGCTGGG - Intergenic
1203151177 16_KI270728v1_random:1843989-1844011 GCAAGGGCTGGGCCCAGGCTGGG + Intergenic
1203151254 16_KI270728v1_random:1844309-1844331 AGCAGGGCTGGGCCAACGTTGGG + Intergenic
1142482514 17:227623-227645 ACCAGGGCTGTCTCCACCCATGG - Intronic
1143233812 17:5380711-5380733 AACTGGGCAGTGCCCAGGCTTGG - Intronic
1143662274 17:8333063-8333085 ACCAGGGCTGTCTCCAGACTAGG + Intergenic
1144830799 17:18130233-18130255 ACCAGGTCTGTGTAGACGCTGGG + Intronic
1144848742 17:18233483-18233505 ACCAGGGCACTGCCCAAGCCAGG - Intronic
1145975485 17:28981595-28981617 AGCATGGCAGTGCCCACCCTAGG - Exonic
1147864879 17:43545651-43545673 ACCAGGTCTCGGCCCCCGCTTGG - Exonic
1147954759 17:44126403-44126425 GCCAGACCTGTGCTCACGCTGGG + Intergenic
1148759009 17:49989809-49989831 ACCATGGCTGTCCCCAATCTGGG - Intergenic
1149169341 17:53791669-53791691 ACCAGGGCTGTGCGCTCGGTGGG + Intergenic
1150428757 17:65099167-65099189 ACCATGGCTGTGGCCAAGCTAGG + Intergenic
1151530249 17:74699647-74699669 ACCAGGGCTGTTGCCACCCTGGG - Intronic
1151822022 17:76501591-76501613 AACAGGGCTCTGCCCAGGCGGGG - Intronic
1152812459 17:82388499-82388521 ACCAGGGCTGTGACCATGGTGGG + Intergenic
1153820249 18:8825938-8825960 ACCAGAGCTGGGCCCAGGCCAGG + Exonic
1154438005 18:14361222-14361244 CACAGGGCTGGGCCCACCCTGGG - Intergenic
1156293463 18:35770241-35770263 CCAAGGCCTGTGCCCATGCTGGG - Intergenic
1156460952 18:37321038-37321060 GCCAGGGCTGTGCCTAGGGTGGG + Intronic
1157578708 18:48760848-48760870 GCCAGGGCTGTGCCCACAGGGGG + Intronic
1158724647 18:59959385-59959407 AAGAGGGCTGAGGCCACGCTGGG - Intergenic
1160322341 18:77907880-77907902 AGGAGAGCTGTGCCCACACTGGG + Intergenic
1161000335 19:1907629-1907651 ACCAGGGTTGTCACCACGCAGGG + Intronic
1163514700 19:17755836-17755858 ACCAGGGCTGAACCCAGCCTTGG + Intronic
1163987956 19:20970719-20970741 GCCAGGGCTCTGCCCACAGTAGG + Intergenic
1164789178 19:30961522-30961544 CCCAGGGCTCTACCCACACTGGG - Intergenic
1165903561 19:39179868-39179890 CCCAGAGCCGAGCCCACGCTGGG + Intronic
1166738976 19:45102865-45102887 TCCAGGGCTGAGCCCACGTCAGG + Intronic
1167227002 19:48251858-48251880 GCTAGGGCTGTGCAGACGCTGGG - Intronic
1167326926 19:48832441-48832463 CCCAGGGCTGTGCCCTCACTTGG - Intronic
1168639179 19:58019514-58019536 ACCAGGGGTGTGCCGATGCCTGG - Intergenic
1168651757 19:58096601-58096623 GCCAGGGCTGGGCCCACGGAGGG - Intronic
1168670100 19:58234444-58234466 GCCAGGGTTGTGCCCTTGCTGGG + Intronic
1202691265 1_KI270712v1_random:96788-96810 ACGAGGGCTGGGCCCAGGCTGGG + Intergenic
925308056 2:2864150-2864172 ACCATGGCTGTGCATAGGCTCGG - Intergenic
925621445 2:5797351-5797373 GCCAGGGCAGTGCCCCCACTTGG - Intergenic
926224089 2:10955098-10955120 ACCAAGGCTGGGCCCAGGCAAGG - Intergenic
933797216 2:85929228-85929250 GCCAGGGCTGTGCGCACACACGG - Intergenic
933955048 2:87356842-87356864 AGCAGGGCTGGGCCAACGTTGGG - Intergenic
933955124 2:87357162-87357184 ACAAGGGCTGGGCCCAGGCTGGG - Intergenic
933971417 2:87472951-87472973 ACCAGGGCTGAGCACAGGCCAGG + Intergenic
934239239 2:90253056-90253078 AGCAGGGCTGGGCCAACGTTGGG - Intergenic
934239314 2:90253376-90253398 ACGAGGGCTGGGCCCAGGCTGGG - Intergenic
934273871 2:91563322-91563344 ACAAGGGCTGGGCCCAGGCTGGG + Intergenic
934461681 2:94216410-94216432 AGCAGGGCTGGGCCAACGTTGGG - Intergenic
936322313 2:111477248-111477270 ACCAGGGCTGAGCACAGGCCAGG - Intergenic
947336211 2:229087407-229087429 ACCAGGACAGTGCCTACCCTTGG + Intronic
948020598 2:234730199-234730221 AGCAATGCTGTGCCCACTCTGGG + Intergenic
948082411 2:235217162-235217184 AGCAGGGCTCATCCCACGCTAGG + Intergenic
948605227 2:239130720-239130742 ACCAGGGCTGTGCCGCAGGTGGG - Intronic
948910059 2:240998463-240998485 ACCTTGCCTGTGCCCACGCCAGG + Intergenic
1168957494 20:1844625-1844647 ACCAGGGATGTGCCCACCTCAGG - Intergenic
1169200336 20:3706199-3706221 ACCAGGCCTGGGCCTACGCCGGG + Intronic
1171310081 20:24138864-24138886 AGCAGGGCTGTGCCCAGGGCAGG - Intergenic
1174104119 20:48149995-48150017 AGCACGGCTGTGCCCACGGAAGG - Intergenic
1175488934 20:59365653-59365675 AACAGGGCTCTGCCCGCTCTTGG - Intergenic
1175894606 20:62330577-62330599 ACCACCCATGTGCCCACGCTGGG - Exonic
1175952677 20:62591638-62591660 ACAAGCACTGTGCCCATGCTGGG - Intergenic
1176457673 21:6928247-6928269 CACAGGGCTGGGCCCACCCTGGG + Intergenic
1176592770 21:8659393-8659415 AGCAGGGCTGGGCCAACGTTGGG - Intergenic
1176592848 21:8659713-8659735 ATGAGGGCTGGGCCCAGGCTGGG - Intergenic
1176835845 21:13793331-13793353 CACAGGGCTGGGCCCACCCTGGG + Intergenic
1179952661 21:44718857-44718879 ACCAAGGCTGCCCCCAGGCTGGG + Intergenic
1180275623 22:10636535-10636557 AGCAGGGCTGGGCCAACGTTGGG - Intergenic
1180275701 22:10636855-10636877 ATGAGGGCTGGGCCCAGGCTGGG - Intergenic
1180550184 22:16531795-16531817 GCAAGGGCTGGGCCCAGGCTGGG - Intergenic
1181038806 22:20182335-20182357 CCCATGCCTGTGCCCACCCTGGG - Intergenic
1181050662 22:20236864-20236886 TCCAGGGCTGGGCCCAAGCAGGG + Intergenic
1181354493 22:22290026-22290048 ACGAGGGCTGGGCCCAGGCTGGG + Intergenic
1181457846 22:23069990-23070012 ACCATGGCTGGGCTCAGGCTTGG + Intronic
1181990579 22:26833803-26833825 ACCCTGGCTGGGCCCACTCTAGG - Intergenic
1182049890 22:27304624-27304646 ACCATGGTTCTGCCCACTCTGGG - Intergenic
1183784815 22:40023259-40023281 AACATGGCTGTGCCCATGCCTGG - Intronic
1184099261 22:42333438-42333460 ACCAGGGCTGTGCACAAGCCTGG + Intronic
1184257904 22:43297408-43297430 TCCAGAGCTGTGCTCATGCTGGG - Intronic
1184403551 22:44287309-44287331 ACCAGGGCTGAGCCCAGGGCCGG + Intronic
1185338675 22:50282155-50282177 GCCAGAGCTGAGCCCACGCCAGG + Intronic
950260906 3:11542995-11543017 ACCAGGCCTGTGCACACGTGTGG - Intronic
950459641 3:13113544-13113566 CCCAGGGCAGTGCCCACCCCAGG - Intergenic
950550398 3:13662645-13662667 CCCACGGCTGTGCCCACGCTAGG + Intergenic
952962286 3:38600001-38600023 ACCAGGGCTGTTTCCAGGCCTGG - Intronic
954388287 3:50255753-50255775 ACAAGGGCTGTGCCTAGGCCAGG + Intronic
955120605 3:56054239-56054261 AGCAGGACTGTGCCCACACATGG + Intronic
955335072 3:58078712-58078734 AACAGGTCTGTGCCCAGACTGGG + Exonic
956775918 3:72565526-72565548 ACCAGTGCTTTGCACACCCTGGG - Intergenic
961603839 3:128079168-128079190 ACCAGGCCTCTGCCCTGGCTGGG - Intronic
967924823 3:194637897-194637919 AGCAGGGCTGTACCCATTCTGGG + Intergenic
967991674 3:195136103-195136125 ACCAGGGCCGTCACCATGCTGGG + Intronic
968600839 4:1508600-1508622 AGCCGGGCTCTGCCCACCCTGGG + Intergenic
969306429 4:6328629-6328651 CCCTGGGCTGAGCCCAGGCTAGG + Intronic
969351962 4:6603325-6603347 CCCAGGGCTGGGCCCAGGATGGG - Intronic
969632330 4:8345973-8345995 AGCAGGGCTGTGCGCAAGCAGGG - Intergenic
969682999 4:8653518-8653540 ACCAGGCAGGTGCCCAGGCTGGG + Intergenic
973760262 4:54109080-54109102 ACCAGGCCTTTGCCCACGCGGGG - Intronic
985263790 4:188139644-188139666 ACAAAAGCTGTGCCCACACTCGG - Exonic
985943275 5:3155887-3155909 ACCCTGGCTGTGCCCGCTCTGGG - Intergenic
987048180 5:14126934-14126956 ACCAATGCTGTGCCCACCATGGG - Intergenic
988354139 5:30151258-30151280 ACCAGGGCAATGCCCAGGGTGGG - Intergenic
1000341428 5:160279997-160280019 AAGAGGGCTGTGCCCAGGCCTGG + Intronic
1003271629 6:4612972-4612994 ACAAGGGCTGTGCCTGCACTTGG + Intergenic
1003369490 6:5510524-5510546 CCCAGGGCTTTGCACACGGTGGG + Intronic
1003719332 6:8682906-8682928 ACCAGCTCTGTGCCTACGTTTGG - Intergenic
1005889416 6:30124543-30124565 AGCAGTTCTGTGCCCACTCTGGG - Intergenic
1006345552 6:33478966-33478988 ACCAGTGATGTGCACACACTGGG - Intergenic
1006807635 6:36798959-36798981 ACCAGGCCTGTGGGCAAGCTGGG - Intronic
1017045523 6:150344067-150344089 ACCAGGGCTGTGGCCAACCTGGG - Intergenic
1017528566 6:155265120-155265142 TCCCGGGCTGTGCTCCCGCTTGG + Intronic
1017909845 6:158783287-158783309 ACCAGGACTGAGCCCACTATCGG + Intronic
1018450287 6:163901272-163901294 TGCAGGCCTGTGCCCAGGCTGGG + Intergenic
1018795967 6:167185917-167185939 ACCACGCCTGTGTCCACGCTCGG - Intronic
1018820351 6:167369147-167369169 ACCACGCCTGTGTCCACGCTCGG + Intronic
1018967981 6:168503477-168503499 AGCAGGGCTGTGCTGAGGCTGGG + Intronic
1019257366 7:60891-60913 CCCAGGGCAGGGCCCACGGTGGG + Intergenic
1019573219 7:1723641-1723663 TCCAGGGCTGTGCCCCGGCCTGG + Intronic
1019633506 7:2063271-2063293 CCCAGGACTCTGCCCACTCTTGG - Intronic
1020258085 7:6513699-6513721 ACCAGGGCTAGGCCCACACGTGG - Intronic
1021141664 7:17033461-17033483 ACCAGGGCTTGGCCGAGGCTGGG + Intergenic
1023343910 7:39251807-39251829 AACACGTCTGTGCCCATGCTGGG - Intronic
1027158500 7:75785269-75785291 ACCAGGGCTGTGCTACCGCAAGG + Intronic
1034449505 7:151129704-151129726 ACAAGGTCTGTGCCCGCGGTGGG - Intronic
1034551128 7:151821374-151821396 ACCAGGATTGGGCCCAGGCTTGG + Intronic
1034873152 7:154701313-154701335 TCCAGTGCTGTGCCCAGGTTTGG + Intronic
1037951317 8:23020041-23020063 ACCAGGGCTGTGCTCCTGCTGGG - Intronic
1039102090 8:33951641-33951663 CACTGGGCTGTGCCCACCCTTGG - Intergenic
1039463234 8:37763072-37763094 GCCAGGCCTGTGCCCACGGATGG + Intronic
1042964760 8:74338569-74338591 ACCTGGGCTGTGGCCAAGCGGGG + Intronic
1046704214 8:117432897-117432919 ACCAGGGCTGTTCCAAGGGTTGG - Intergenic
1048986740 8:139738808-139738830 ACCAGCTCTGCGCCCAGGCTGGG - Intronic
1049404647 8:142446986-142447008 CCCAGTGCTGGGCCCACCCTGGG + Intergenic
1049839341 8:144761047-144761069 ACCAAGGCTGTGGCCATGCCAGG + Intergenic
1053692233 9:40592382-40592404 ATGAGGGCTGGGCCCAGGCTGGG - Intergenic
1054272567 9:63045103-63045125 ATGAGGGCTGGGCCCAGGCTGGG + Intergenic
1054272646 9:63045423-63045445 AGCAGGGCTGGGCCAACGTTGGG + Intergenic
1054303412 9:63393028-63393050 AGCAGGGCTGGGCCAACGTTGGG - Intergenic
1054303491 9:63393348-63393370 ATGAGGGCTGGGCCCAGGCTGGG - Intergenic
1054402192 9:64719538-64719560 AGCAGGGCTGGGCCAACGTTGGG - Intergenic
1054435797 9:65203853-65203875 AGCAGGGCTGGGCCAACGTTGGG - Intergenic
1054435873 9:65204173-65204195 ATGAGGGCTGGGCCCAGGCTGGG - Intergenic
1054494519 9:65817514-65817536 ATGAGGGCTGGGCCCAGGCTGGG + Intergenic
1054494596 9:65817834-65817856 AGCAGGGCTGGGCCAACGTTGGG + Intergenic
1060186232 9:121565804-121565826 ACCAAGGCTGTGCACTCTCTGGG + Intergenic
1061869988 9:133515399-133515421 ACCAGGGCTGTGCCCACGCTGGG - Intronic
1062111316 9:134783542-134783564 ACCACGGCTGTGCCCACCGGAGG - Intronic
1203622894 Un_KI270749v1:138519-138541 ATGAGGGCTGGGCCCAGGCTGGG - Intergenic
1197745477 X:129930088-129930110 ACCAGGACGGTGCCGAAGCTGGG + Intergenic
1198095626 X:133377175-133377197 ACCAGGGCTCTGCCAACTGTGGG + Intronic