ID: 1061870993

View in Genome Browser
Species Human (GRCh38)
Location 9:133520460-133520482
Sequence CTCCCGCAGAGGGTCCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 204}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061870987_1061870993 7 Left 1061870987 9:133520430-133520452 CCGTCTGAAAAATGGGGGTACTG 0: 1
1: 0
2: 10
3: 105
4: 680
Right 1061870993 9:133520460-133520482 CTCCCGCAGAGGGTCCTGTGGGG 0: 1
1: 0
2: 0
3: 14
4: 204
1061870980_1061870993 18 Left 1061870980 9:133520419-133520441 CCTCAGTCTCCCCGTCTGAAAAA 0: 1
1: 3
2: 76
3: 890
4: 4869
Right 1061870993 9:133520460-133520482 CTCCCGCAGAGGGTCCTGTGGGG 0: 1
1: 0
2: 0
3: 14
4: 204
1061870985_1061870993 9 Left 1061870985 9:133520428-133520450 CCCCGTCTGAAAAATGGGGGTAC 0: 1
1: 0
2: 13
3: 217
4: 1675
Right 1061870993 9:133520460-133520482 CTCCCGCAGAGGGTCCTGTGGGG 0: 1
1: 0
2: 0
3: 14
4: 204
1061870986_1061870993 8 Left 1061870986 9:133520429-133520451 CCCGTCTGAAAAATGGGGGTACT 0: 1
1: 0
2: 4
3: 64
4: 526
Right 1061870993 9:133520460-133520482 CTCCCGCAGAGGGTCCTGTGGGG 0: 1
1: 0
2: 0
3: 14
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061870993 Original CRISPR CTCCCGCAGAGGGTCCTGTG GGG Intronic
900600795 1:3501908-3501930 CTCCTGCAGAGTGCCCGGTGGGG - Exonic
901458281 1:9376442-9376464 CTCTCCCAGAGGGTCCTGTAGGG - Intergenic
901784642 1:11616757-11616779 CTCCCTCAGGGGGTCCTCAGTGG - Intergenic
902242854 1:15100314-15100336 CTCCTGCTGAGGGTCCTGGGTGG - Intronic
902348283 1:15835194-15835216 CCCCCGGAGAGGGGCCCGTGTGG - Intergenic
903594936 1:24486825-24486847 CTCCCTGTGAGGGGCCTGTGAGG + Intergenic
904688711 1:32277828-32277850 CTTCCTCACAGGGTCTTGTGAGG + Intronic
904770237 1:32877072-32877094 CTGCCTCATAGGGTTCTGTGAGG + Intergenic
904969079 1:34404982-34405004 CTCCAGCAGTGGGTCCTGATGGG - Intergenic
906614248 1:47224085-47224107 CTCCCACAGCGGGTTCTTTGGGG - Exonic
907193442 1:52667561-52667583 CTACCTCACAGGGTTCTGTGAGG - Intronic
908976980 1:69910400-69910422 CTGCAGCTGAGGGTCCTGTCTGG - Intronic
908978656 1:69928020-69928042 CTGCAGCTGAGGGTCCTGTCTGG - Intronic
909931340 1:81503042-81503064 CTCCCGCAGCTGCTCCAGTGCGG - Intronic
914911339 1:151790131-151790153 CTCCCGCACCGGGTCCGTTGTGG + Intronic
915244068 1:154543954-154543976 TTCCCGCAGAGGGTCCTTCCTGG + Exonic
917965951 1:180178650-180178672 CTCCCTTGGAGGGCCCTGTGTGG + Intronic
919739450 1:200973316-200973338 CTCACCCAGAGGCTCCTGAGAGG + Intronic
923239143 1:232063443-232063465 CTTCAGCAGAGACTCCTGTGGGG + Intergenic
1066235423 10:33480545-33480567 CTCCCCCATGGGCTCCTGTGCGG - Intergenic
1067771787 10:49131802-49131824 CTCCAGCAGAGCGTCCAGGGAGG + Exonic
1069736735 10:70661558-70661580 CTCCCGCACAGGGTCTTTGGAGG + Intergenic
1070805649 10:79269203-79269225 CTACTTCAGAGGGTCTTGTGTGG + Intronic
1073094104 10:100969519-100969541 CTCTCGCAGCTGGTGCTGTGGGG + Intronic
1074303278 10:112251823-112251845 CTGCAGCTGAGGGTCCTGTCTGG + Intergenic
1075016812 10:118915746-118915768 CTTCAGTAAAGGGTCCTGTGGGG - Intergenic
1075677936 10:124309036-124309058 CTGCAGCAGAGGGTGGTGTGTGG + Intergenic
1076740043 10:132478457-132478479 CCCCTGCAGCAGGTCCTGTGGGG + Intergenic
1077259448 11:1608070-1608092 CTCCAGCTGTGGCTCCTGTGGGG - Exonic
1077259485 11:1608202-1608224 CTCCAGCTGTGGCTCCTGTGGGG - Exonic
1077261198 11:1621868-1621890 CTCCAGCTGTGGCTCCTGTGGGG - Exonic
1079303393 11:19299618-19299640 CTACCACAAAGGGTCTTGTGAGG + Intergenic
1082810721 11:57477302-57477324 ATCCCCCAAAGGGTCCTGGGTGG - Exonic
1083890191 11:65592138-65592160 CTCCCGCAGAGGGCTGCGTGTGG + Intronic
1084490747 11:69476867-69476889 GTCCCGCCCAGGGTCCTGCGAGG + Intergenic
1084798787 11:71527462-71527484 CTCCAGCTGTGGCTCCTGTGGGG + Exonic
1084800118 11:71538196-71538218 CTCCAGCTGTGGCTCCTGTGGGG + Exonic
1084803891 11:71565770-71565792 CTCCAGCTGTGGCTCCTGTGGGG + Exonic
1084806475 11:71582654-71582676 CTCCAGCTGTGGCTCCTGTGGGG - Exonic
1085319806 11:75567006-75567028 CTCTTGCAGGGGGTCCTGGGAGG - Intronic
1085733703 11:79020930-79020952 CAGCTGCAGAGGGTACTGTGGGG - Intronic
1087102884 11:94381870-94381892 CTGCCCCAGAGCCTCCTGTGGGG + Intronic
1090998885 11:131891635-131891657 CCACCGCAGAGAGCCCTGTGGGG - Intronic
1095416026 12:41978396-41978418 CTGCAGCTGAGGGTCCTGTCTGG - Intergenic
1095423325 12:42048704-42048726 CTGCAGCTGAGGGTCCTGTCTGG - Intergenic
1095424869 12:42063895-42063917 CTGCAGCTGAGGGTCCTGTCTGG + Intergenic
1095428996 12:42112069-42112091 CTGCAGCTGAGGGTCCTGTCTGG + Intronic
1096004351 12:48157111-48157133 CTCCCGCAGCAGGTGCGGTGGGG - Intronic
1096259616 12:50082420-50082442 CTCCGGGAGAGGGACCAGTGAGG - Exonic
1096539864 12:52300962-52300984 CTCCCTCAGAGTGTCCCATGCGG - Intronic
1096959279 12:55561355-55561377 CTGCAGCAGAGGGTCCTGCCTGG + Intergenic
1100308850 12:93376540-93376562 CTCTGGCAGAGGGGCCTGTGAGG - Intergenic
1103280714 12:119756037-119756059 CTCCTTTATAGGGTCCTGTGGGG - Intronic
1103797020 12:123510189-123510211 CTCCGGCTGTGGGTCCTGTGAGG + Intronic
1104729727 12:131098165-131098187 CTCCCGCAGTGGCTGCTGTCTGG + Intronic
1106248017 13:27965164-27965186 ACCCCCCAGAGGGTCCTGTGGGG + Intronic
1106543073 13:30707243-30707265 CTCCACAAGAGGGTCCTATGTGG + Intergenic
1110194018 13:72765192-72765214 CTACCTCATAGGGTGCTGTGAGG - Intronic
1112518685 13:100077799-100077821 CTCCTCCATAGGCTCCTGTGCGG + Intergenic
1112701355 13:102012731-102012753 CTCCCGCACTGGGGCTTGTGAGG + Intronic
1113780769 13:112975895-112975917 CTATGGCAGAGGGGCCTGTGAGG - Intronic
1114250472 14:20955674-20955696 TGGCCGCAGAGGGGCCTGTGGGG + Intronic
1114630719 14:24157823-24157845 CTCACGCAGGGGTTCCTGAGAGG + Intronic
1117556871 14:56895043-56895065 CTCCAGCTGAGAGTCCTCTGAGG - Intergenic
1121329701 14:93042088-93042110 CTCCTGCAGTGGGTGTTGTGAGG - Intronic
1121713992 14:96059825-96059847 CTCCTGCTGAGGGTCTTCTGTGG + Intronic
1122630968 14:103107623-103107645 CTCCTGCAGAGTCTCCTGGGCGG - Exonic
1125723340 15:41855647-41855669 CCGCCGCAGAAGGGCCTGTGTGG + Exonic
1126353401 15:47768837-47768859 CAACCGCAGAAGCTCCTGTGAGG - Intronic
1126778731 15:52120357-52120379 CTCTCGCAGTGGGTGCTGTCGGG - Exonic
1129064617 15:72890373-72890395 CTCCTGCAGAAGGGCCAGTGAGG - Intergenic
1129294334 15:74591650-74591672 CTCCCGCAGCTGCTCCAGTGCGG - Exonic
1129653870 15:77510085-77510107 CACCCGCAGATGCCCCTGTGGGG - Intergenic
1129935989 15:79450808-79450830 AACCTGCAGAGGGTGCTGTGAGG + Intronic
1132001968 15:98189690-98189712 CTCCCGCATAGGCTTCTGTAAGG - Intergenic
1132367778 15:101270042-101270064 CACCAGCAGAGGCTGCTGTGGGG - Intergenic
1132537900 16:492411-492433 CTCCCGGGGAGGGCCCTGGGCGG - Intronic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1132997076 16:2828988-2829010 CTCCCCCTGAGGGTGCTGTGAGG - Intergenic
1135642817 16:24135611-24135633 CTCCAGCAGATGATGCTGTGAGG - Intronic
1138349732 16:56340043-56340065 CTCCTGCAGAGAGCCCGGTGCGG - Intronic
1139468836 16:67167615-67167637 CTGCCCCTGAGGGGCCTGTGGGG + Intronic
1140442443 16:74998629-74998651 GTCCACCAGAGGGTGCTGTGGGG + Intronic
1141131967 16:81443551-81443573 CTCGGGGAGAGGGTCCTCTGGGG + Intergenic
1141422545 16:83926176-83926198 CTGCCGCTGGGGGTGCTGTGTGG + Exonic
1141896332 16:86961028-86961050 CTGCTGCATTGGGTCCTGTGGGG - Intergenic
1142005552 16:87688006-87688028 CTCCCCGTGAGGGTCCTGTGTGG - Intronic
1142276779 16:89122974-89122996 CTGTCGCAGAGGCCCCTGTGCGG - Intronic
1142633781 17:1243761-1243783 CGCCCGCAGAGAGTTCTGTGAGG - Intergenic
1142953370 17:3503024-3503046 GTCCAGCAGAAGGTCCTTTGAGG - Exonic
1143761626 17:9108415-9108437 CACACGCAGAGGCTACTGTGAGG + Intronic
1144744336 17:17603676-17603698 CTCCCCCAGAGGCTCCTTTTGGG - Intergenic
1144999231 17:19291835-19291857 CTTCCGTAGAGAGTCCTCTGAGG - Intronic
1145254285 17:21314267-21314289 CCCCCGCAGATGGGGCTGTGGGG - Exonic
1145274063 17:21419666-21419688 CCCACCCAGAGGGTCCTGGGGGG + Exonic
1145311928 17:21705565-21705587 CCCACCCAGAGGGTCCTGGGGGG + Intergenic
1145413749 17:22695415-22695437 CCACCTCTGAGGGTCCTGTGAGG - Intergenic
1147648112 17:42046122-42046144 CTCACGCATAGGGAGCTGTGGGG - Intronic
1148015084 17:44516027-44516049 CTACCACAGGGGGTCCTGTATGG - Intergenic
1148052116 17:44774588-44774610 CTCCCCCAGAGGCCCCCGTGTGG + Intronic
1148605598 17:48926956-48926978 CTCTCCAAAAGGGTCCTGTGGGG - Exonic
1151747192 17:76017981-76018003 TGCCCACAGAGGGTCCTGTCGGG + Intronic
1151813405 17:76458730-76458752 CTCCCGCAGAGGGCAGTGTTGGG - Intronic
1152331625 17:79676921-79676943 CTCCCTCCGAGGATCCAGTGTGG - Intergenic
1152690769 17:81716742-81716764 CTCCCACAGAGGGTCCTCCCAGG - Intronic
1153292216 18:3512650-3512672 CTGCCTCACAGGGTCCTGCGAGG - Intronic
1155038299 18:22043777-22043799 GTTCTGCAGATGGTCCTGTGTGG + Intergenic
1157355287 18:46928301-46928323 CTGCAGCTGAGGGTCCTGTCTGG - Intronic
1160390654 18:78528979-78529001 CTGCCGGCGAGGGTGCTGTGGGG + Intergenic
1160806446 19:994204-994226 CTCCCGCAGAGCGTGCTCGGCGG + Exonic
1160923482 19:1531738-1531760 CTCTCCCAGGGGGTCCTGTGTGG - Exonic
1163023507 19:14496134-14496156 CTCCCGCAGCGGCGCCTGGGGGG + Intronic
1164616942 19:29672961-29672983 CACCAACAGAGGGGCCTGTGTGG + Intronic
1165505810 19:36228369-36228391 CTCCCACTCAGGGTCCTGAGAGG - Intronic
1165559710 19:36668321-36668343 CTCCCGCAGTGGCCCCTGTGGGG + Intergenic
1166304619 19:41930598-41930620 CTCCCAAAGGGTGTCCTGTGTGG - Intergenic
1166751928 19:45168363-45168385 CTCCAGCTCAGGGTCCTGGGTGG + Intronic
1166882370 19:45937404-45937426 CTTCCTCATAGGGTCCTGGGGGG + Exonic
1166959710 19:46490069-46490091 CCCCTGCAGAGGGCCCTGAGCGG - Intronic
1167461034 19:49624896-49624918 CTCCGGAAGAGGGGGCTGTGCGG + Exonic
1168187626 19:54709889-54709911 CTCCCCCAGCAGGGCCTGTGCGG - Intergenic
925381802 2:3433384-3433406 CTCCCGCAGACCCTTCTGTGAGG + Intronic
927324056 2:21782659-21782681 CTCACACAGAGGCTCCTGTAAGG + Intergenic
927870353 2:26619234-26619256 CCCCCGGGGAGGGCCCTGTGGGG - Intronic
928606429 2:32947864-32947886 CGCCCGCGGAGGGACCTGCGGGG + Intronic
928968768 2:37004592-37004614 CTCCCGCAGAGGATTGTTTGAGG - Intronic
930393741 2:50793796-50793818 CTCATGCTGAGGGTCCTCTGGGG - Intronic
934806355 2:97230855-97230877 CTGCAGCTGAGGGTCCTGTCTGG - Intronic
934831155 2:97526329-97526351 CTGCAGCTGAGGGTCCTGTCTGG + Intronic
937283208 2:120734905-120734927 CACCCGAAGAGGGTCTTGGGGGG - Intergenic
938685907 2:133737438-133737460 CTACCCCAGAGGGTGCTGTATGG + Intergenic
939355018 2:141090041-141090063 CTCCCCATTAGGGTCCTGTGTGG + Intronic
941427554 2:165367876-165367898 CTCCCCTAGACGCTCCTGTGGGG - Intronic
942105478 2:172629353-172629375 CTCCACCAGTGGGGCCTGTGGGG - Intergenic
943032924 2:182707002-182707024 CTCCCTCAAAGAATCCTGTGGGG - Intergenic
948426068 2:237887144-237887166 CTCTGGCTGTGGGTCCTGTGTGG + Intronic
1169496554 20:6121487-6121509 CTCATGCAGAGGGTTCTGTGTGG - Intronic
1171810256 20:29741337-29741359 CTCCCCCCGCAGGTCCTGTGTGG - Intergenic
1172954785 20:38748516-38748538 CTCCAGCACTGGGTCCGGTGCGG - Exonic
1174575584 20:51534739-51534761 GTCCCCCAGAGGGTTCTCTGTGG + Intronic
1175332199 20:58173106-58173128 CTTCAGCAGAGGCTGCTGTGGGG + Intergenic
1175895051 20:62332466-62332488 CCCCGGCACAGGGTGCTGTGGGG + Exonic
1175923041 20:62458923-62458945 CGGCCGCACAGGGTACTGTGGGG + Intergenic
1175946399 20:62561029-62561051 CTTCCCCTGGGGGTCCTGTGTGG + Intronic
1179494643 21:41764018-41764040 GTGCCTCGGAGGGTCCTGTGGGG - Intronic
1180965938 22:19788018-19788040 TGCCCGCAGAGGGTGCAGTGGGG - Exonic
1183743104 22:39679099-39679121 GTCCCGCAGCGTGTCCTGCGTGG - Exonic
1183975277 22:41508443-41508465 CTCCCGGAGAGGGTCCTTGGAGG - Intronic
1184383956 22:44163788-44163810 CTCCAGCAGTGGGCCGTGTGTGG + Intronic
1184602954 22:45554305-45554327 CTCCCCCAGGGGGGCCTCTGAGG - Intronic
1184649345 22:45912565-45912587 CCCCAGGAGAGGGGCCTGTGGGG + Intergenic
1184772866 22:46608029-46608051 CTTGCGCTGAGGGTCCTGTCGGG + Intronic
949425344 3:3909714-3909736 CTGCAGCTGAGGGTCCTGTCTGG + Intronic
950462968 3:13136062-13136084 GTCCCGCAGGCGGCCCTGTGGGG - Intergenic
950510183 3:13420911-13420933 CTTCCGCAGGGGGTGCAGTGCGG - Intergenic
953196827 3:40742216-40742238 GTCCTGCAGAGTGTCCTGAGAGG - Intergenic
954931457 3:54285854-54285876 CTGCAGCTGAGGGTCCTGTCTGG + Intronic
954949988 3:54463987-54464009 CTGCAGCTGAGGGTCCTGTATGG - Intronic
955560737 3:60187085-60187107 TTCTTTCAGAGGGTCCTGTGGGG + Intronic
962238322 3:133728870-133728892 CTGCAGCTGAGGGTCCTGTCTGG - Intergenic
966595191 3:181719568-181719590 CTCCCCAAGAAGGTGCTGTGTGG + Intergenic
966878734 3:184338004-184338026 CTCCTGCAAAGGGTCCAGGGTGG + Intronic
968754297 4:2407372-2407394 GTCCAGCAGAGGCCCCTGTGAGG + Intronic
968944152 4:3654837-3654859 CACCCCACGAGGGTCCTGTGAGG + Intergenic
973257469 4:48127895-48127917 CACCCCCAGAGGTTCCTGGGTGG + Intronic
974591436 4:63953291-63953313 CTGCAGCTGAGGGTCCTGTCTGG - Intergenic
975271598 4:72441791-72441813 CACCAGCAGATGGTTCTGTGTGG - Intronic
984954495 4:185031946-185031968 CTACTGCAGAGGTTACTGTGGGG - Intergenic
985133278 4:186760194-186760216 CACCCGCCGAGGGGGCTGTGGGG + Intergenic
985686103 5:1282584-1282606 CTCACGCAGACGGTGCTCTGCGG + Exonic
985718369 5:1475650-1475672 CTCCCGTAGTGGGTCCTAGGAGG - Intronic
990558830 5:56963702-56963724 TTCCCTAAGAGGGTCCTCTGTGG - Intronic
991241849 5:64469983-64470005 CTGCAGCTGAGGGTCCTGTCTGG - Intergenic
991242774 5:64478012-64478034 CTGCAGCTGAGGGTCCTGTCTGG + Intergenic
996544975 5:124668605-124668627 CTACCCCAGAGGCTGCTGTGTGG - Intronic
999625487 5:153516411-153516433 TTCCCCCAAAGGGTGCTGTGGGG - Intronic
1001084056 5:168687468-168687490 CTCCCTTACAGGGTCCTGAGAGG - Intronic
1001274490 5:170340503-170340525 CCACTGCAGAGGGTCCCGTGGGG + Intergenic
1001965516 5:175907406-175907428 TTCCTGCAGAGGGACCTGGGTGG - Intergenic
1002251434 5:177931788-177931810 TTCCTGCAGAGGGACCTGGGTGG + Intergenic
1002677269 5:180927218-180927240 CTGCAGCAGAGGGTCCTGACTGG + Intronic
1006839330 6:37018334-37018356 GTCCAGGAGAGGGTGCTGTGCGG - Intronic
1012310567 6:97719471-97719493 CTCCAGCAGAATGTCATGTGGGG + Intergenic
1017753484 6:157510391-157510413 TGCCTGCAGAGGGGCCTGTGTGG - Intronic
1018968957 6:168512114-168512136 CCCACTCAGAGGGTCCTCTGAGG + Intronic
1019067196 6:169312260-169312282 CTCTCGCAGCTGGTCCTGTAGGG + Intergenic
1019400030 7:847414-847436 ATCCCGGAGAGGGTGCTGCGGGG - Intronic
1021706342 7:23371873-23371895 CTCTCTCAGAGAGTCCAGTGTGG - Intronic
1022910622 7:34896987-34897009 CTCTCACTTAGGGTCCTGTGTGG - Intergenic
1023339604 7:39205808-39205830 CTCCCCCAAAGGGTCCTGAAAGG + Intronic
1023842663 7:44105831-44105853 CTCCTGCTTAGGGTCCTGGGAGG + Intronic
1024280192 7:47712085-47712107 CTCCCTCAGAGGTTTCTGTGAGG + Intronic
1026872123 7:73859267-73859289 CTCCAGCAGATGGTCGGGTGGGG - Intergenic
1029452234 7:100647519-100647541 CTCCCGGACAGGCTCCTGTGGGG + Exonic
1031530115 7:122865902-122865924 TTCCTGCAGAGGGTGCTGGGTGG - Intronic
1032690516 7:134282368-134282390 CTCCAGCAGTGGTTACTGTGGGG + Intergenic
1034994745 7:155570725-155570747 CACTCGCGGAGGGGCCTGTGAGG - Intergenic
1035210673 7:157325821-157325843 AACCCGTACAGGGTCCTGTGTGG + Intergenic
1039835641 8:41254238-41254260 TTCCAGCAGAGGGGCCAGTGAGG + Intergenic
1047624248 8:126639725-126639747 CTGCCTCACAGGGTACTGTGAGG + Intergenic
1048759992 8:137783399-137783421 CTCCCTCACAGGGTCTTATGGGG - Intergenic
1049299303 8:141861346-141861368 CTCCCACGGTGGGTCCTGTCTGG - Intergenic
1049477466 8:142803456-142803478 GTCCTGCAGAGTGTCCTGTAGGG + Intergenic
1055304014 9:74910163-74910185 CTCCCTCAGCTGGGCCTGTGAGG - Intergenic
1056452439 9:86729237-86729259 CTCCCTCCCAGGGTTCTGTGGGG - Intergenic
1058793112 9:108470964-108470986 CTCCCTCTGAGCGTGCTGTGTGG - Intergenic
1060549791 9:124479507-124479529 CTCACCCAGCGGGTCATGTGAGG + Intergenic
1060809758 9:126604840-126604862 CTTCCACAGAGGGTCCAGCGGGG + Intergenic
1060989165 9:127838440-127838462 CTCCCCCAGACTGTCCTGGGAGG - Intronic
1061870993 9:133520460-133520482 CTCCCGCAGAGGGTCCTGTGGGG + Intronic
1062150990 9:135018949-135018971 CTCAGGCAGAGGGCTCTGTGTGG - Intergenic
1062720859 9:138043282-138043304 TCCCAGGAGAGGGTCCTGTGAGG - Intronic
1187590122 X:20708236-20708258 CTCCCTCACAGGGTTTTGTGAGG - Intergenic
1187707782 X:22024992-22025014 CTCCCACATATGGCCCTGTGTGG + Intergenic
1192194255 X:69018140-69018162 CTCCCGCCAACAGTCCTGTGAGG + Intergenic
1195909539 X:109875843-109875865 CTCCACCAGCGGCTCCTGTGCGG - Intergenic
1197607975 X:128606909-128606931 CTCCCGCGTGGGCTCCTGTGCGG + Intergenic
1198932475 X:141876055-141876077 ATCCTGCTGAGGGTCCTGTCAGG + Intronic
1200956141 Y:8948261-8948283 CTGCAGCAGAGGGTCCTGACTGG - Intergenic