ID: 1061872390

View in Genome Browser
Species Human (GRCh38)
Location 9:133527906-133527928
Sequence CAGGGGAAGCGATTGGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061872377_1061872390 21 Left 1061872377 9:133527862-133527884 CCAGCTCTGAACAGGACTGAAAT 0: 1
1: 0
2: 0
3: 17
4: 149
Right 1061872390 9:133527906-133527928 CAGGGGAAGCGATTGGCCTGGGG No data
1061872380_1061872390 -4 Left 1061872380 9:133527887-133527909 CCCTCGGTTCTCCCTGGAGCAGG 0: 1
1: 0
2: 2
3: 18
4: 157
Right 1061872390 9:133527906-133527928 CAGGGGAAGCGATTGGCCTGGGG No data
1061872382_1061872390 -5 Left 1061872382 9:133527888-133527910 CCTCGGTTCTCCCTGGAGCAGGG 0: 1
1: 0
2: 1
3: 24
4: 189
Right 1061872390 9:133527906-133527928 CAGGGGAAGCGATTGGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061872390 Original CRISPR CAGGGGAAGCGATTGGCCTG GGG Intronic
No off target data available for this crispr