ID: 1061874689

View in Genome Browser
Species Human (GRCh38)
Location 9:133537744-133537766
Sequence CCTGGTGCCCTGAAGCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 205}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061874689_1061874699 26 Left 1061874689 9:133537744-133537766 CCTTCATGCTTCAGGGCACCAGG 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1061874699 9:133537793-133537815 CCATTTCTAGAGGTCTGTCCTGG No data
1061874689_1061874693 -3 Left 1061874689 9:133537744-133537766 CCTTCATGCTTCAGGGCACCAGG 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1061874693 9:133537764-133537786 AGGAAAGCCCTTTCACGAGAGGG No data
1061874689_1061874700 29 Left 1061874689 9:133537744-133537766 CCTTCATGCTTCAGGGCACCAGG 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1061874700 9:133537796-133537818 TTTCTAGAGGTCTGTCCTGGAGG No data
1061874689_1061874694 1 Left 1061874689 9:133537744-133537766 CCTTCATGCTTCAGGGCACCAGG 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1061874694 9:133537768-133537790 AAGCCCTTTCACGAGAGGGCAGG No data
1061874689_1061874697 16 Left 1061874689 9:133537744-133537766 CCTTCATGCTTCAGGGCACCAGG 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1061874697 9:133537783-133537805 AGGGCAGGAGCCATTTCTAGAGG No data
1061874689_1061874692 -4 Left 1061874689 9:133537744-133537766 CCTTCATGCTTCAGGGCACCAGG 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1061874692 9:133537763-133537785 CAGGAAAGCCCTTTCACGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061874689 Original CRISPR CCTGGTGCCCTGAAGCATGA AGG (reversed) Intronic
902399920 1:16152150-16152172 CTTTGGGCCCTGGAGCATGAGGG + Intronic
902467108 1:16625182-16625204 CCTGGATCCCTGAAACATTAAGG + Intergenic
902507483 1:16947578-16947600 CCTGGATCCCTGAAACATTAAGG - Intronic
902870127 1:19308939-19308961 CCTGGAGCCCTAGAGGATGATGG + Intronic
903414783 1:23174895-23174917 ACGGTTGCCCTGAAACATGAGGG - Intronic
905312417 1:37059139-37059161 CCTGGGGCCATGAAACAGGACGG - Intergenic
906293787 1:44636730-44636752 CCCTCTGCCCTGAAGCAAGAGGG + Intronic
907558993 1:55371199-55371221 TCTGAGGCCATGAAGCATGAGGG + Intergenic
912691909 1:111810983-111811005 CCTGAGGCCCTGAAGCTGGAGGG - Intronic
912945495 1:114080945-114080967 CCTGGTGCTCAGAAGAATAATGG + Intergenic
914349982 1:146832364-146832386 CCTGGAGCCTTGAAGCATAGTGG + Intergenic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
919839777 1:201600359-201600381 CCTTTTCCCCTGAAGCATGGTGG + Intergenic
920998058 1:211014102-211014124 GCTGGTGCCCTGGAGCCTGAAGG - Intronic
921332858 1:214057335-214057357 ACTGCTTCCCTGAAGCAAGAGGG + Intergenic
921720266 1:218463505-218463527 TGTGGTGCCCAGAAGCATAAAGG - Intergenic
923353237 1:233129445-233129467 CCTGGTGCCGTGGAGCAAGGGGG - Intronic
923713256 1:236403824-236403846 CCTGGTGAACTGATGCATCAGGG - Intronic
1065605816 10:27416401-27416423 CCTGGGTTCCTGAAGCATCATGG + Intergenic
1066063615 10:31746039-31746061 TCAGCTGCCCTGAAGGATGAGGG - Intergenic
1066199691 10:33132911-33132933 CCTGGTGGAGTGAACCATGAAGG - Intergenic
1068638359 10:59373342-59373364 CCTTGGGCCCTGAAGCAGTAGGG + Intergenic
1069598197 10:69686446-69686468 CCTGGTGCCCTGGTGCGTGGAGG + Intronic
1070527955 10:77311395-77311417 CCTGGTGCCGAGAAGCAGGGAGG - Intronic
1071154247 10:82671159-82671181 CATAGTACGCTGAAGCATGATGG - Intronic
1071909923 10:90220052-90220074 CTGGCTGCCCTGAAGCATCACGG + Intergenic
1071953679 10:90733528-90733550 CCTGATGCCCTGATGTCTGAAGG - Intergenic
1074815073 10:117136973-117136995 CCGGGTCCCCTGTAGCCTGAGGG + Intronic
1076541993 10:131220432-131220454 CCTGGTGCCCTGACTCACAAGGG + Intronic
1076570890 10:131432228-131432250 CGTGCTGGCTTGAAGCATGAAGG + Intergenic
1077242785 11:1519462-1519484 CCTGCTCCCCTGTAGCATGCTGG - Intergenic
1082790548 11:57343868-57343890 CCTGGGGCCCTGCAGAGTGAAGG - Intronic
1082971560 11:59028158-59028180 CCTGGGGCCCTTAAGGATTATGG - Intronic
1083343925 11:61976560-61976582 CCTGCAGCCCTGAATCCTGAAGG + Intergenic
1084001336 11:66296719-66296741 CATCGTGCCCTGAACCATGGGGG - Intergenic
1084412221 11:69011657-69011679 CCAGGCGCCCGGAAGGATGAGGG - Intronic
1084960650 11:72714494-72714516 CCTGGTTCCCCGAAGCCTAAAGG + Intronic
1085931595 11:81089663-81089685 CCTGATGCCAAGAATCATGAAGG + Intergenic
1088746850 11:112811171-112811193 TCTGTTGCCCAGGAGCATGAAGG - Intergenic
1089634541 11:119803882-119803904 CCTGTAGCCCTGCAGCATGAGGG + Intergenic
1090646007 11:128767096-128767118 CCTGGCGCCCTGAAGCTGGCTGG - Intronic
1092260713 12:6951968-6951990 CCTGGTGCCCTGCAGGGTGGGGG + Exonic
1092388446 12:8053938-8053960 CGTCGTGCCCTGAGACATGATGG + Exonic
1093177326 12:15926857-15926879 ACGGGTGCCCTAAGGCATGAGGG - Intronic
1093310694 12:17579264-17579286 CCCTGTACCCTGAAGTATGAGGG - Intergenic
1093479685 12:19591828-19591850 CCTGGTTGCATGAAGCATTAAGG - Intronic
1094221776 12:28001713-28001735 TCTGGTGGCCTGGGGCATGAGGG - Intergenic
1094361386 12:29634977-29634999 CCTCCTGCCCTGCAGCCTGATGG - Intronic
1094455561 12:30628878-30628900 CCTGGTGACCTGAAGCAAGGTGG - Intergenic
1096504666 12:52085190-52085212 CATGGAGCCCTGAATCATGCTGG - Intergenic
1096604986 12:52758224-52758246 CCTGGTGGCATGAAGACTGAAGG - Intergenic
1098168402 12:67720558-67720580 CCAGTTCCCCTGAAGCATGTGGG + Intergenic
1098623043 12:72628103-72628125 CCTGGTGACTTTCAGCATGATGG - Intronic
1102218910 12:111180982-111181004 CCTGGGACCCTGTAGTATGAAGG - Intronic
1102305893 12:111804194-111804216 ACTGATGGCCTCAAGCATGAGGG - Intronic
1102704130 12:114866638-114866660 CCTGGTGGCATGCAGCCTGAGGG + Intergenic
1103497604 12:121374768-121374790 CCGGGTGCCGTGGAGCAGGAGGG - Intronic
1105277875 13:18946839-18946861 CATGGTGCCCAGAAGAATGGGGG - Intergenic
1113710510 13:112461502-112461524 CCAGGTGCCCTTAAGAAGGATGG + Intergenic
1114495756 14:23131042-23131064 CAGGCTGCCCTGAAGCTTGATGG + Intronic
1119530512 14:75357075-75357097 CCAGGTGCCCTGAAGGATTCTGG - Intergenic
1120702033 14:87708452-87708474 CCTAGTTCCCTGAAGGCTGAAGG - Intergenic
1121020765 14:90578761-90578783 CCTGATGCCAAGAAGTATGATGG + Intronic
1121340157 14:93100219-93100241 CCTGTGGACCTGGAGCATGAGGG + Intronic
1121585560 14:95060773-95060795 CCTGGGGCCCTGGAGCAGGTGGG - Intergenic
1121606939 14:95247428-95247450 CATGGTGCCATCAGGCATGAAGG + Intronic
1122857326 14:104566084-104566106 CATGGTGCCCTCCAGCCTGAGGG - Intronic
1122893415 14:104743415-104743437 GCTGATGCCGTGAAGGATGAGGG + Intronic
1123105365 14:105838961-105838983 CCTGGGGCCCTGGAGCATGGTGG + Intergenic
1126183554 15:45809565-45809587 CCTGGTGCCCTGACCCACCAAGG + Intergenic
1126530920 15:49710630-49710652 CCTGGATCCCTGAACCATGAGGG + Intergenic
1131121300 15:89824712-89824734 CCAGGTGCCCTGGAGCAATATGG - Intergenic
1135745992 16:25016414-25016436 CGTGGAACACTGAAGCATGATGG - Intergenic
1139984056 16:70883167-70883189 CCTGGAGCCTTGAAGCATAGTGG - Intronic
1142037644 16:87871543-87871565 GCTGGAGCCCTTAAGCAGGAAGG + Intergenic
1143117517 17:4589168-4589190 CCTGGTCCCCTGGGGCATCATGG + Intronic
1144205607 17:12977540-12977562 CTTGGTGCCAAGAAGCAGGAAGG - Intronic
1144476465 17:15593336-15593358 CCTGTTGCCCTGAATAAAGAAGG + Exonic
1144921792 17:18770064-18770086 CCTGTTGCCCTGAATAAAGAAGG - Exonic
1144944570 17:18963353-18963375 CCTGCTGCCCTGAAGCAGCCAGG + Intronic
1146483213 17:33221955-33221977 AATAGAGCCCTGAAGCATGATGG - Intronic
1146626156 17:34437065-34437087 CCTGGTGCCCTGCCGCCTCAAGG + Intergenic
1146949241 17:36894338-36894360 CCTCATGCCCTGAAGCATGAGGG + Intergenic
1147369351 17:39980962-39980984 CCGGGTGCCATGAAGCAGGAGGG + Exonic
1148842424 17:50507865-50507887 CCTGGAGCCCTGAGGCATTCTGG - Intergenic
1150952670 17:69821196-69821218 CCTGGGGCCCAGAAGCAGGCAGG + Intergenic
1152298327 17:79481264-79481286 ACTGGAGCCCTGAAGCCTGCAGG - Intronic
1152709985 17:81866614-81866636 GTTAGTGACCTGAAGCATGAGGG + Intergenic
1157595545 18:48861556-48861578 CCTGCCCCCCTGAAGCATGTGGG + Exonic
1158403074 18:57138806-57138828 TCTGGTGCCCTGAGGAAGGAAGG + Intergenic
1160327948 18:77967966-77967988 CATGGTGCAGTGAAGCCTGAAGG + Intergenic
1161527114 19:4763162-4763184 CCTGGTTCCCTGGAGGATGAGGG + Intergenic
1162917408 19:13881761-13881783 CCTGGAGACCTGATGCAGGAGGG - Intergenic
1163020219 19:14477605-14477627 CCTGGTGGCCTGCAGCCAGAAGG + Intergenic
1163708500 19:18831862-18831884 CCTGGTGCCCAGCAGGAAGACGG - Intergenic
1163755392 19:19103662-19103684 CCTAGGGCCCAGAAGCAAGATGG + Intronic
1163768965 19:19179266-19179288 CCAGGGGGCCTGAAGCAGGAGGG - Intronic
1164697928 19:30260859-30260881 CCAGGGGGTCTGAAGCATGAAGG - Intronic
1165463558 19:35958953-35958975 CCTGGTTCCCTCAAGCCCGACGG + Intergenic
1167086589 19:47314066-47314088 CCAGGTGACGTGAGGCATGACGG - Intronic
1167852785 19:52214691-52214713 CCTGGTGCCATGAAACAGGCAGG + Intronic
1168632889 19:57971319-57971341 GATGGTGGCCTGGAGCATGAGGG - Intronic
925123521 2:1437818-1437840 CCTCCTGCCCTGAAGCCTGGGGG + Intronic
925498581 2:4479780-4479802 CCTGCTGCCCTGAACAATGTTGG - Intergenic
925873102 2:8287677-8287699 ACTGGGGCCCTGAAGCAAGGGGG + Intergenic
926586781 2:14695444-14695466 CCTGGTGCACAAAGGCATGAGGG + Intergenic
927132344 2:20071404-20071426 CCTGCAGCCCTGAAGCGGGAAGG - Intergenic
929231670 2:39566625-39566647 CCTGGCTCCCTGAGCCATGATGG - Intergenic
929871209 2:45760847-45760869 CCTGGTGTCCAGAGGCATAAAGG + Intronic
931472466 2:62552840-62552862 GCTGGTGCCCAGAAGCATGTTGG - Intergenic
931853378 2:66276181-66276203 CCTGGGGCCCTGCAGGATGTTGG + Intergenic
931872925 2:66481106-66481128 CCTGATCCCCTGCAGCAGGAGGG + Intronic
933792450 2:85893920-85893942 TCTGCTGCCCTGAAGCACAAAGG + Intergenic
934913978 2:98283391-98283413 ACTGGTGACCTGAAGCAAGGTGG + Intronic
935193707 2:100798498-100798520 CCTTGTGTCCTGGAGCATCAGGG + Intergenic
937252717 2:120534536-120534558 ACTGATGCCCTGAAGCCTGGGGG - Intergenic
937832960 2:126444001-126444023 CCTGGTACCCTGAAGAGTGTTGG - Intergenic
938293414 2:130162243-130162265 CCTGCTGCCCTGCAGCACCACGG + Intronic
940308846 2:152255433-152255455 GCTGGTGACCTGAACCAAGAAGG + Intergenic
942590823 2:177544953-177544975 ACTGATGACCTGAAGCTTGACGG - Intergenic
943689311 2:190852891-190852913 CCTCATGCCCTGGAGCAGGAGGG + Intergenic
944085955 2:195848316-195848338 CATGGTGCCAGGAATCATGATGG - Intronic
945049087 2:205806483-205806505 CCTGATGCCCAGAAGGCTGAGGG - Intergenic
948053929 2:234997461-234997483 CCTGGTGTCCTTCAGGATGAAGG + Intronic
948281169 2:236748963-236748985 CATGTTCCCCTGAAGCATGCGGG + Intergenic
948632286 2:239309906-239309928 CCTGGTCCCATGGGGCATGAAGG + Intronic
948777540 2:240297493-240297515 CCTGGTTCCCTGAAGACAGAGGG - Intergenic
949039951 2:241843674-241843696 ACTGGAGCCCTGACGCACGAGGG + Intergenic
1169889255 20:10434759-10434781 CCTGGAACCCAGAAGCAGGATGG - Intergenic
1170358321 20:15517231-15517253 GGTGGTGGCCTGGAGCATGAGGG - Intronic
1171259463 20:23718737-23718759 CCAGCTGCCCTGAAGCTTCATGG + Intergenic
1172514934 20:35526873-35526895 CCTAGTGCCCTGGATCATGTAGG - Intronic
1173933357 20:46840137-46840159 TCTGGAGCCCTGAAGCAGGCAGG + Intergenic
1174163384 20:48567516-48567538 TCTGGGGCCCTGAAGCAGGTGGG - Intergenic
1174553472 20:51377964-51377986 CCTGGTGACCTGACGCCTGGCGG - Intergenic
1176289473 21:5036487-5036509 CCCCGTGCCCTCAGGCATGAGGG - Intronic
1178780638 21:35599760-35599782 GCTGATGCCCTGAAGTATGTTGG - Intronic
1179229380 21:39487841-39487863 CCTGGTGACCTGAAGGAGGAAGG + Intronic
1179255836 21:39714540-39714562 CCTGGAGGCCAGAAGCCTGAGGG + Intergenic
1179867757 21:44227100-44227122 CCCCGTGCCCTCAGGCATGAGGG + Intronic
1181495503 22:23285283-23285305 CCTGGGGCCCAGAGGCCTGACGG - Intronic
1182413211 22:30204499-30204521 CCTGGGGCCCTGGAGAATGGTGG - Intergenic
1184459352 22:44628317-44628339 GCTGGTGCCCTGAGCCATGCTGG + Intergenic
1184500793 22:44870400-44870422 CCTGGAGCCCTGAAGCAGTGAGG - Intergenic
1184682250 22:46078689-46078711 CCCCGTGCCATGGAGCATGAGGG + Intronic
1185395463 22:50584761-50584783 CCAGGAGCCCTGAAGCATCATGG + Intronic
950480830 3:13242763-13242785 CCCGGTGACGTGAAGCCTGAAGG - Intergenic
952043139 3:29283992-29284014 CCTGTTACACTGAAACATGATGG - Intronic
954164651 3:48746525-48746547 CCTGGAGCCCTGAAGCAAAATGG + Intronic
955335039 3:58078399-58078421 CCTGGTGCCTTTATGCAGGAGGG - Intronic
955594058 3:60569523-60569545 CCTGGTGTCTTCAAACATGAAGG - Intronic
962286839 3:134093447-134093469 CTTGGAGCCCTGATGCATAAAGG + Intronic
965276592 3:166691191-166691213 GCTGGTGCCCAGAAGAATGTTGG + Intergenic
968658141 4:1787383-1787405 CCAGGTGCCCAGCGGCATGAGGG - Intergenic
975442997 4:74434161-74434183 CCTGGTCATCTGAAGCTTGATGG + Intergenic
976162518 4:82218671-82218693 GCTTGTGCCCTGCATCATGATGG - Intergenic
986485995 5:8237734-8237756 CCTTGTGGCCTGGAACATGAAGG + Intergenic
987245374 5:16043018-16043040 CCTGTGGCCCTTAAGCATTAAGG + Intergenic
992000842 5:72434780-72434802 CCTGGTTCCCTGAAGCACTGTGG - Intergenic
992459203 5:76944350-76944372 CCTGGTGCTCTGGAGGAAGATGG + Intergenic
994301506 5:98153411-98153433 CCTGTTGCCCTGTAGAATGTTGG + Intergenic
998741122 5:145203233-145203255 CCTGTTGCCCAGAACCATGTGGG + Intergenic
998890873 5:146744401-146744423 CATGGTGCACTGAAGCCTAAGGG - Intronic
999154570 5:149449450-149449472 CCTGAGGCCCTGAAGCAAGCAGG + Intergenic
999356256 5:150934935-150934957 CCTTCTGCCATGCAGCATGAAGG + Intergenic
1002130667 5:177079677-177079699 CCCGGTGCCCTGGACCATGGAGG - Intronic
1002645179 5:180649348-180649370 CCTGGTGCGCGGACGCCTGAGGG - Intronic
1003277824 6:4667319-4667341 CCTGGTGCCAAAAAGGATGAGGG + Intergenic
1005153003 6:22774256-22774278 CCTGATGCCCAGAACCATGGTGG + Intergenic
1006532982 6:34672924-34672946 CCTAGTGCCCTGAAATTTGACGG - Intronic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007943858 6:45807708-45807730 TCTGGTGACCTGAAGCAGGATGG + Intergenic
1008417646 6:51261567-51261589 TCTCTTGCCCTGAAGCCTGATGG - Intergenic
1008482972 6:52005960-52005982 CCTGCGGCCCTAAAGCATGTGGG + Intronic
1008563623 6:52746386-52746408 CCTGTGGCCCTGAAACATGTGGG - Intergenic
1008572251 6:52827265-52827287 CCTGTGGCCCTGAAACATGTGGG - Intergenic
1008899450 6:56594980-56595002 CCTGCTTCCCTGAAGACTGAGGG - Intronic
1010151988 6:72743952-72743974 CCTGTAGACATGAAGCATGAGGG - Intronic
1011071607 6:83391737-83391759 CCTGGAGACCAGAAGCAGGATGG - Intronic
1011331956 6:86218260-86218282 CCTGGTACCAGGAAGCATAATGG - Intergenic
1014915040 6:127136328-127136350 CCTGTTGCCCTAAAGTAAGATGG + Intronic
1015937549 6:138418341-138418363 CCTGGGGCCCTGAAGGAAGGTGG + Exonic
1017825437 6:158078229-158078251 CCTGGTGCCCTGCAGTATTATGG + Exonic
1019840707 7:3440178-3440200 CCTTGTGCCCTGTAAAATGAAGG + Intronic
1019889449 7:3934620-3934642 CCAGATGCTCTGAAGCATGCAGG + Intronic
1026759526 7:73116055-73116077 CCTGGGGCCCTGCTGCTTGATGG + Intergenic
1027087884 7:75277418-75277440 CCTGGGGCCCTGCTGCTTGATGG - Intergenic
1028687845 7:93612457-93612479 CATGGTGCAATGAAGCTTGAGGG - Intronic
1029393996 7:100294564-100294586 CCTGGGGCCCTGCTGCTTGATGG - Intergenic
1033245618 7:139714411-139714433 CCTGGTGCCCAGCAGGCTGAGGG + Intronic
1033443136 7:141397940-141397962 CCTGCTGCCCTGATGCCAGAGGG - Intronic
1034140108 7:148807674-148807696 GCTGATGCCCTGAAGTATGTCGG - Exonic
1034463066 7:151209225-151209247 TCTGGTGCCCTGAAGAAGGTGGG - Intronic
1034471165 7:151255087-151255109 CCTGGTGCCCTCAAGGCCGAGGG - Intronic
1034546886 7:151795039-151795061 CCTGGGGCCCTGAACTAGGAAGG - Intronic
1036238653 8:7064407-7064429 CCTGGTGACCTGCAGGAAGATGG + Intergenic
1037643637 8:20771058-20771080 CCTGGTCCCCTGTAGCCTGGTGG + Intergenic
1038466216 8:27766292-27766314 CCTGGAGCCCTGAAGGACAAAGG + Intronic
1040355787 8:46617308-46617330 CCTGGTACACTGAGGCATGAAGG - Intergenic
1040675183 8:49740722-49740744 TCTGGTGCCCAGAAGAATGTTGG - Intergenic
1041272003 8:56117941-56117963 GCTGGTGCCCGGAAGCACGTGGG + Intergenic
1042945829 8:74153624-74153646 CCTGATGTCCTGAAGCAAGAGGG + Intergenic
1043737609 8:83767961-83767983 GGTGGTGCCCAGAAGCTTGAAGG + Intergenic
1045692595 8:104774908-104774930 CCTGGGGACCAGAAGTATGAAGG - Intronic
1046996972 8:120534362-120534384 CCTGATCACCTGAAGCTTGATGG - Intronic
1048880636 8:138869741-138869763 CCTGGTGACCTGCAGCTGGAGGG + Intronic
1049604643 8:143523673-143523695 CCTGGTGGCGTGAAGCCTGGCGG - Intronic
1054769273 9:69068936-69068958 CATGGTGCTGTGAAGCATGCAGG - Intronic
1055639475 9:78308429-78308451 GCTGGTGCCCAGAAGAATGTTGG + Exonic
1056994442 9:91443315-91443337 CCAGATGGCCTGAAGCATGGGGG - Intergenic
1057275427 9:93673718-93673740 CATGGTGCCCGGAAGAATGGGGG + Exonic
1060482403 9:124024381-124024403 CCAGGTGCCCTGAATGCTGATGG + Intronic
1060668540 9:125448094-125448116 CCTGGTTCCCTGGAGCCTGGAGG + Intronic
1061874689 9:133537744-133537766 CCTGGTGCCCTGAAGCATGAAGG - Intronic
1187412272 X:19061914-19061936 CCAGGAGCCCTGCAGGATGAGGG - Intronic
1191680312 X:63833591-63833613 CCTGGATCCATGAAACATGATGG + Intergenic
1193131337 X:77922769-77922791 TCTGGTGCCCTAAAGGACGAAGG - Intronic
1195252470 X:103062887-103062909 CCTTATGCCCTGAATCCTGATGG - Exonic
1195278670 X:103309580-103309602 CCTTATGCCCTGAATCCTGATGG - Exonic
1195856658 X:109339017-109339039 CCTGGAGACATCAAGCATGAGGG + Intergenic
1195961453 X:110391344-110391366 TGTGGTGCCCCCAAGCATGATGG - Intronic
1197862207 X:130982910-130982932 CATGCTGCCCTGAAACCTGAAGG - Intergenic