ID: 1061874984

View in Genome Browser
Species Human (GRCh38)
Location 9:133539181-133539203
Sequence TAGGGCAGTGCAGCCAGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061874977_1061874984 -5 Left 1061874977 9:133539163-133539185 CCTGGTCAGCTGCCCTCCTAGGG 0: 1
1: 0
2: 1
3: 28
4: 288
Right 1061874984 9:133539181-133539203 TAGGGCAGTGCAGCCAGGGTTGG No data
1061874974_1061874984 15 Left 1061874974 9:133539143-133539165 CCGCTTCTGTGTTGGCGTCACCT 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1061874984 9:133539181-133539203 TAGGGCAGTGCAGCCAGGGTTGG No data
1061874973_1061874984 18 Left 1061874973 9:133539140-133539162 CCACCGCTTCTGTGTTGGCGTCA 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1061874984 9:133539181-133539203 TAGGGCAGTGCAGCCAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061874984 Original CRISPR TAGGGCAGTGCAGCCAGGGT TGG Intronic
No off target data available for this crispr