ID: 1061875110

View in Genome Browser
Species Human (GRCh38)
Location 9:133539706-133539728
Sequence CTGGACAAAAATGCCTTTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 207}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061875099_1061875110 22 Left 1061875099 9:133539661-133539683 CCCGGCTGTCCCGGCTGTCCCGG 0: 1
1: 0
2: 4
3: 34
4: 235
Right 1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG 0: 1
1: 0
2: 6
3: 38
4: 207
1061875102_1061875110 13 Left 1061875102 9:133539670-133539692 CCCGGCTGTCCCGGCTGCAGCCA 0: 1
1: 0
2: 1
3: 66
4: 474
Right 1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG 0: 1
1: 0
2: 6
3: 38
4: 207
1061875103_1061875110 12 Left 1061875103 9:133539671-133539693 CCGGCTGTCCCGGCTGCAGCCAC 0: 1
1: 0
2: 8
3: 47
4: 415
Right 1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG 0: 1
1: 0
2: 6
3: 38
4: 207
1061875101_1061875110 21 Left 1061875101 9:133539662-133539684 CCGGCTGTCCCGGCTGTCCCGGC 0: 1
1: 0
2: 2
3: 35
4: 238
Right 1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG 0: 1
1: 0
2: 6
3: 38
4: 207
1061875105_1061875110 3 Left 1061875105 9:133539680-133539702 CCGGCTGCAGCCACTTCCTGCTT 0: 1
1: 0
2: 6
3: 43
4: 538
Right 1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG 0: 1
1: 0
2: 6
3: 38
4: 207
1061875104_1061875110 4 Left 1061875104 9:133539679-133539701 CCCGGCTGCAGCCACTTCCTGCT 0: 1
1: 0
2: 7
3: 53
4: 512
Right 1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG 0: 1
1: 0
2: 6
3: 38
4: 207
1061875107_1061875110 -7 Left 1061875107 9:133539690-133539712 CCACTTCCTGCTTAGCCTGGACA 0: 1
1: 0
2: 2
3: 17
4: 242
Right 1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG 0: 1
1: 0
2: 6
3: 38
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061875110 Original CRISPR CTGGACAAAAATGCCTTTGT CGG Intronic
900848900 1:5126468-5126490 GGGGACTAAACTGCCTTTGTAGG + Intergenic
901357122 1:8660726-8660748 CTGGAGAAAAATAGCTTTGGGGG - Intronic
904751382 1:32742843-32742865 CTGGAGAAACATGCCAGTGTCGG + Intronic
909412233 1:75367850-75367872 TGGGAAAAAAATGCCTTTGTGGG - Intronic
912848204 1:113096250-113096272 CTGGATGAATCTGCCTTTGTGGG + Exonic
919707997 1:200697310-200697332 CTGAACAAAAATCACTTGGTTGG + Intergenic
919876656 1:201874260-201874282 CTGGACAAACATTCCTTTGCTGG + Exonic
923892485 1:238231488-238231510 AGGGACAATAATGCATTTGTGGG - Intergenic
1065622736 10:27599932-27599954 ATGGACAAAAGTGCCCTTGTGGG - Intergenic
1066320640 10:34300356-34300378 CTGGCCAAAATTACCTTTTTAGG - Intronic
1067774180 10:49150145-49150167 CTGGACACAAAGGAGTTTGTTGG - Intergenic
1068254901 10:54497004-54497026 CTGGACCATAGTGCTTTTGTTGG + Intronic
1068495932 10:57785653-57785675 AGGAACAAAAATGCCTTTTTTGG - Intergenic
1068583241 10:58766616-58766638 ATGGACAAGAGTACCTTTGTGGG + Intronic
1069130246 10:64691959-64691981 CTGGACAAAAAATACTTTGATGG + Intergenic
1069893387 10:71665802-71665824 CTGGCCACAAATCCCTTTGGAGG + Intronic
1072298570 10:94037194-94037216 TTTCACAAAAATGCCTTTGTTGG + Intronic
1075952597 10:126494776-126494798 CTTGAAATAAATGCCCTTGTAGG - Intronic
1076289846 10:129336890-129336912 CTGGACAAAGATTACTTTGGAGG - Intergenic
1077476552 11:2793024-2793046 CTGGACAAGCATCCCTTTGCGGG - Intronic
1077541902 11:3150612-3150634 CTGGAGAAACATGCCTCTGGGGG + Intronic
1080546365 11:33322880-33322902 CAGGAAGAAAATGCCTTTGATGG - Intronic
1081165738 11:39807666-39807688 CATGACAAAAATATCTTTGTAGG + Intergenic
1081572954 11:44302830-44302852 CTGGACAAAAATGCGTGTGGGGG + Intronic
1082714962 11:56600879-56600901 TTGGACAGAAATGGCTTTGGAGG + Intergenic
1082867498 11:57913178-57913200 GGGGACTAAATTGCCTTTGTAGG - Intergenic
1083083220 11:60114740-60114762 CTGAAAAAAAATGCATTAGTGGG + Intergenic
1084350184 11:68591831-68591853 ATGGCCAGAAATGCCCTTGTTGG + Intronic
1085025383 11:73233434-73233456 CTGGCCAGAAATGCCTCTGCAGG + Intronic
1089070049 11:115692830-115692852 CTGGACAAAGAAGACTTTGGTGG + Intergenic
1089755354 11:120682216-120682238 CTGGAAAGAAATGCATTTGGTGG + Intronic
1090459047 11:126873794-126873816 TTGGACAAAAATGCTTTTTCAGG + Intronic
1091226364 11:133958578-133958600 TTGGGCAAAGATGCCTTTCTGGG + Intergenic
1095881401 12:47141257-47141279 ATGGACAAAAGTGCCTTTGTGGG + Intronic
1098666659 12:73171591-73171613 ATTGACAAAAATGCATTTTTTGG + Intergenic
1098821248 12:75232545-75232567 ATGGACAAAATTGCCTTTGTGGG - Intergenic
1099231222 12:80027616-80027638 ATGTTCAAAAGTGCCTTTGTGGG - Intergenic
1100584566 12:95968124-95968146 TATCACAAAAATGCCTTTGTGGG + Exonic
1101784801 12:107873576-107873598 CTGGACAAAGATGCCCACGTCGG + Intergenic
1108114189 13:47109732-47109754 CTGGAGAACAATGCGCTTGTAGG - Intergenic
1108555617 13:51588873-51588895 CTGGATAAAAAGGCCTGTGTTGG + Intronic
1108567909 13:51719359-51719381 CTGGACAAAAATCTCTTAGTGGG + Intronic
1109179902 13:59201272-59201294 CTGGAGAAAAATGACTTTTTAGG - Intergenic
1111079700 13:83287154-83287176 CTTGACAAAATTCCCTTTGATGG - Intergenic
1111256568 13:85677250-85677272 GAGGACTAAACTGCCTTTGTAGG - Intergenic
1111268475 13:85850443-85850465 CGGGAGAAAAATGGTTTTGTGGG - Intergenic
1116681974 14:47983842-47983864 ATGGACAAAAGAGCCTTTGTGGG + Intergenic
1118537392 14:66783057-66783079 CTAGACAAACAGGCTTTTGTAGG - Intronic
1120264579 14:82232847-82232869 AGGGACAAAAATTCCTTTCTTGG + Intergenic
1121935332 14:98013272-98013294 CTGGTAAAAATTGCCTTTCTAGG - Intergenic
1122321695 14:100859396-100859418 CTGGACCAACATGTCTTTGTTGG + Intergenic
1122339245 14:101017355-101017377 CTGAAAAAAAATGGCTATGTAGG + Intergenic
1122422821 14:101588177-101588199 CTGGACCAAAATCCCTTCCTGGG + Intergenic
1123501228 15:20882848-20882870 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123558480 15:21456553-21456575 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123594711 15:21893828-21893850 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1126731050 15:51683176-51683198 CTGAACTAAAATGGCTGTGTTGG + Intronic
1127002430 15:54525286-54525308 CTAGATAACAAAGCCTTTGTTGG - Intronic
1128193212 15:65724624-65724646 CTGAACAAAAATGACTGTCTTGG + Intronic
1128440215 15:67700075-67700097 CTGAACAGAAATTCCTTTTTTGG + Intronic
1130718592 15:86363193-86363215 GCAGACAAAAGTGCCTTTGTAGG - Intronic
1130833890 15:87630661-87630683 GGGGACAAGATTGCCTTTGTAGG + Intergenic
1131495105 15:92901613-92901635 CTGCAGAAAAATGACCTTGTCGG + Intronic
1202966830 15_KI270727v1_random:183703-183725 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1133517858 16:6527369-6527391 CTGTACAGAAATCACTTTGTTGG - Intronic
1134302737 16:13006003-13006025 AGGGACACACATGCCTTTGTGGG - Intronic
1137378040 16:47971441-47971463 CTGGCCATAAATGCATTCGTGGG + Intergenic
1138394236 16:56691874-56691896 CTGGACAGACATCCCTTTGGTGG + Intronic
1138510949 16:57508172-57508194 CTGGACAAAATGGCCTTGGCTGG + Intergenic
1138825095 16:60309332-60309354 GGGGACTAAATTGCCTTTGTAGG - Intergenic
1138962707 16:62046321-62046343 CTGGATGGAAATGCCTTGGTTGG + Intergenic
1140533738 16:75690175-75690197 TTTGACCGAAATGCCTTTGTGGG + Intronic
1143865715 17:9921657-9921679 TGGGACAAGAATGCCTTTGTTGG + Intronic
1144281547 17:13732011-13732033 CTGGAGAACAATGCCTGTCTGGG - Intergenic
1148221803 17:45868150-45868172 GAGGACTAAACTGCCTTTGTAGG + Intergenic
1148342667 17:46882904-46882926 CTGCACAGGAATGCCTGTGTGGG - Intronic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1149012856 17:51875309-51875331 CAGGTCAAAACTGCCTTTCTAGG - Intronic
1149083280 17:52683893-52683915 CTGTACAATAAAGCCTTGGTAGG + Intergenic
1150606653 17:66697351-66697373 ATGGACAAGAGTGTCTTTGTAGG + Intronic
1150868866 17:68882177-68882199 CCTGAAAAAACTGCCTTTGTAGG - Intronic
1151273994 17:73020195-73020217 CTCGAAAAAAATTCATTTGTTGG + Intronic
1203171846 17_GL000205v2_random:155589-155611 CTGGAATCCAATGCCTTTGTTGG - Intergenic
1153186314 18:2490399-2490421 CAATACAAAAATGCCTTTGTAGG + Intergenic
1155247680 18:23925412-23925434 CTCAAGAAAAATGCCCTTGTTGG - Intronic
1158377674 18:56889337-56889359 TTGGACAAAAATGTCTTTCAGGG - Intronic
1159624005 18:70670450-70670472 GTGGACAAAAGTGCCTTTGTGGG - Intergenic
1162397847 19:10427831-10427853 GTGAACAAAAATGCATTTCTGGG + Intronic
1163911858 19:20202787-20202809 CCTGACAAAAATGCCTTTATTGG + Intergenic
1164415363 19:28042771-28042793 CTTGACAAACATGTCATTGTCGG + Intergenic
1164935546 19:32207692-32207714 CTGGAAAGAAATGCCTTTCCAGG + Intergenic
1165494082 19:36141736-36141758 ATGGAGAAAAATGCCCTGGTAGG + Intronic
1166419883 19:42628413-42628435 AGGGACTAGAATGCCTTTGTAGG + Intronic
1166497980 19:43318567-43318589 GGGGACAAGACTGCCTTTGTGGG - Intergenic
1167921845 19:52788580-52788602 CAGGTCAAAATTGCCCTTGTAGG - Intronic
1167957331 19:53076736-53076758 ATGGACCAAATTGTCTTTGTGGG + Intronic
925408436 2:3624753-3624775 ATGAACAAAAGTGTCTTTGTAGG - Intronic
925584813 2:5453985-5454007 CTGGAAAAAAAAACATTTGTGGG - Intergenic
925732129 2:6926724-6926746 CTGGACTCAAATGTCTTTGAAGG - Intronic
925947891 2:8882606-8882628 ATGGGCAAAAATGCCATTTTGGG - Intronic
927957317 2:27217018-27217040 CTGGCGAAAGATGCCTTTCTAGG - Exonic
929372445 2:41242224-41242246 ACGAACAAAAGTGCCTTTGTGGG - Intergenic
930341525 2:50121950-50121972 CTGAAGAAAATTGCCTTTGCAGG - Intronic
932235066 2:70114393-70114415 ATGAGCAAAAATGCCTCTGTGGG + Intergenic
932254780 2:70275149-70275171 ACGGACATCAATGCCTTTGTGGG + Exonic
932915374 2:75852672-75852694 CTTGAGAAAAAAGCCTTTGAAGG + Intergenic
933463558 2:82621137-82621159 CTGTCCAAAATTGGCTTTGTTGG - Intergenic
933646721 2:84819163-84819185 CTGGACAAATAGTCCTTTATGGG - Intronic
933741393 2:85537450-85537472 CTGGAACAAAATGCGTGTGTAGG - Intergenic
940316195 2:152330108-152330130 CTAGAAAAAAATTACTTTGTTGG + Intergenic
940612859 2:156011946-156011968 GGGGACTAGAATGCCTTTGTAGG - Intergenic
941972023 2:171361166-171361188 CTGCACAAAAATGTCTTTCTTGG + Intronic
942223708 2:173796329-173796351 GGGGACTAAACTGCCTTTGTAGG + Intergenic
942475556 2:176316172-176316194 GTGGACCAAATAGCCTTTGTAGG + Intronic
943024457 2:182610136-182610158 CTGGACAAATAGGCCTTGCTGGG + Intergenic
945346567 2:208724778-208724800 CTAGACAATGATGCATTTGTAGG - Intronic
948227784 2:236325248-236325270 GTTGAGAAAAATGCCATTGTGGG - Intronic
1171253314 20:23667166-23667188 CTGGATGAACATGCCTTTATGGG - Intergenic
1171259788 20:23722420-23722442 CTGGATGAACATGCCTTTATGGG - Intergenic
1174417712 20:50378533-50378555 ACGGACAAAAATTCCTTTGCTGG + Intergenic
1177420605 21:20852041-20852063 GGGGACAAGACTGCCTTTGTAGG - Intergenic
1178688723 21:34732912-34732934 CTGGACACAAAAGCCATTTTTGG - Intergenic
1179299353 21:40092311-40092333 CTGACCAAAAATACCTCTGTTGG + Intronic
1179538674 21:42069190-42069212 CTGGAGAAAAATGCCTTCCATGG + Intronic
1181429467 22:22869847-22869869 ATAGAAAAAAATGCCTTTGATGG - Intronic
949099369 3:125628-125650 CTGGACACACAGGGCTTTGTAGG + Intergenic
951733439 3:25836492-25836514 ATGAACAAAACTGCCTTTGTGGG + Intergenic
951925065 3:27900493-27900515 CTTGACTAAAATGTTTTTGTGGG + Intergenic
953220030 3:40961074-40961096 ATGGACAAATGTGCCTTTGTAGG - Intergenic
953228427 3:41042457-41042479 CTGAACAGAAATGCATTTGCAGG - Intergenic
954493700 3:50931985-50932007 ATGGACAAGAGTACCTTTGTGGG - Intronic
954823220 3:53348972-53348994 CTGGACAAAAATATTTATGTGGG - Intergenic
955252003 3:57292896-57292918 CTGGAATAAAATGCTTTTGCAGG + Intergenic
956007419 3:64795847-64795869 CTGAACAAAAATTCATTTGAAGG + Intergenic
956902099 3:73727653-73727675 CTGGATCAGAATGCCTTTGGGGG - Intergenic
957375508 3:79352037-79352059 CTGTTCAAAATTACCTTTGTTGG - Intronic
957507033 3:81135310-81135332 ATGGACATAAAATCCTTTGTTGG + Intergenic
959851236 3:111089709-111089731 CTTGAAAAAATTGCCTTTGTTGG + Intronic
959939555 3:112066556-112066578 CAGGACAAAAATACCTCTGATGG + Intronic
960437948 3:117650504-117650526 CAGGTTATAAATGCCTTTGTAGG - Intergenic
964331067 3:155603605-155603627 ATAGAGAAAAATGCCTTTTTAGG - Intronic
966567259 3:181396902-181396924 ATGGAAAAAAGTGCCATTGTGGG - Intergenic
967388801 3:188935178-188935200 GTAGACAAAAGTGCCTTTGGAGG + Intergenic
971008782 4:22406699-22406721 CAGGTCAAAAATGCTCTTGTGGG - Intronic
971986646 4:33833881-33833903 TTTGACACAAATGCCTTTGATGG + Intergenic
972134098 4:35870366-35870388 CTGGAGAAAAATTGCTTTATTGG - Intergenic
972743778 4:41913484-41913506 GGGGACAAGAATGCCTTTGTAGG + Intergenic
973770045 4:54198053-54198075 ATGGATAAAAATGCCATTGGGGG - Intronic
974100236 4:57408225-57408247 CTGGAAAATAGTGACTTTGTGGG + Intergenic
974481185 4:62445744-62445766 ATAGACAAAAGTTCCTTTGTGGG + Intergenic
974721406 4:65743631-65743653 TTTGAAAAAATTGCCTTTGTTGG - Intergenic
976093666 4:81484120-81484142 TTGTTCAAAAATGCCTTGGTTGG - Intronic
977981409 4:103327395-103327417 CTGGTTAAAAATGCCTTTGATGG - Intergenic
978369542 4:108016559-108016581 CTTGACAAAACTCCCTTTTTTGG - Intronic
978489446 4:109296584-109296606 CTGGACAAGAATGATTTTGAAGG - Intronic
979801461 4:124914177-124914199 ATAGACAAAATTGCCTTTGTGGG - Intergenic
980330577 4:131405256-131405278 CTGATAAAAAATGCCTTTCTTGG - Intergenic
980626611 4:135381436-135381458 AGGGACTAAACTGCCTTTGTAGG + Intergenic
981261203 4:142721353-142721375 TTGCACAAAAATGCTTTTGTTGG + Intronic
981508587 4:145530124-145530146 CTGGACTGTAATGCCTTTGTGGG - Intronic
982981491 4:162141977-162141999 CAGGACAAAATTACCTTTGGTGG - Intronic
983946451 4:173591098-173591120 ATGGAGAAAAATCCCTTTCTGGG - Intergenic
984693715 4:182757550-182757572 CTTGATTAAAATGCATTTGTAGG - Intronic
986406667 5:7432291-7432313 CTGGACAAGAATGTGTGTGTGGG + Intronic
986966678 5:13281231-13281253 CGGGACAAAAATGTCTAGGTGGG + Intergenic
988035049 5:25817129-25817151 CTGGACAAAAAGGGCTTTCTGGG + Intergenic
988165109 5:27578769-27578791 CAGGACAAAGAAGCCTATGTAGG - Intergenic
988167278 5:27610143-27610165 GTGGAAAAAAATGTCTTTTTAGG + Intergenic
989690716 5:44140494-44140516 CAGGATAATAATGGCTTTGTAGG + Intergenic
991151298 5:63373829-63373851 TTGAAAAAAAATGCCTTTGGTGG + Intergenic
992627751 5:78649538-78649560 CTGGACAAGAATGCCTTTTCAGG - Intronic
992824738 5:80537514-80537536 ATGGATAAAAGTACCTTTGTGGG - Intronic
993194393 5:84722445-84722467 ATGGACAAAAGTGCCTTTGTGGG + Intergenic
993790930 5:92210250-92210272 CAGGACCAATTTGCCTTTGTAGG - Intergenic
994622020 5:102175028-102175050 CTGGAGAGAAATCACTTTGTAGG + Intergenic
994793158 5:104258041-104258063 ATGGACAAGAATACCTTTATGGG - Intergenic
995281299 5:110338682-110338704 GTGGACCAACCTGCCTTTGTAGG - Intronic
996174459 5:120337970-120337992 ATGTACAAAAAGGCCTTTCTTGG - Intergenic
999600216 5:153254121-153254143 CTGGAGAGAAATGCCTTCTTGGG - Intergenic
1001573543 5:172746882-172746904 GAGGACAAACATGCCTTGGTTGG - Intergenic
1001660762 5:173391027-173391049 CATAGCAAAAATGCCTTTGTGGG + Intergenic
1002297095 5:178237821-178237843 CTGGCCAAAAATGGCTCTCTAGG - Exonic
1003193201 6:3892069-3892091 GTTGACAAAAATGCCCTGGTTGG + Intergenic
1003700216 6:8456170-8456192 TAGGACAAGAAAGCCTTTGTTGG + Intergenic
1004101887 6:12621018-12621040 CTGTTAAAATATGCCTTTGTTGG + Intergenic
1004413280 6:15401085-15401107 TTGGAGAAATAGGCCTTTGTGGG + Intronic
1006751031 6:36377138-36377160 CTTGACACATTTGCCTTTGTGGG + Intronic
1007190929 6:40017798-40017820 CTGGACAAAAGTGTCCTTGTGGG + Intergenic
1008679711 6:53859127-53859149 GTGGACAAAGCTGCCTCTGTAGG + Intronic
1009010536 6:57837124-57837146 GAGGACAAAAAGGTCTTTGTGGG - Intergenic
1009625775 6:66137647-66137669 GGGGACTAAATTGCCTTTGTAGG + Intergenic
1010843628 6:80678324-80678346 CTGGACTCAACTGCCTTTGTAGG - Intergenic
1011181421 6:84625905-84625927 CTGGACCAAAAGGCCTTTGGAGG - Intergenic
1012380305 6:98612923-98612945 CAGGACAAAACTGGCTTTGCTGG - Intergenic
1015835843 6:137419113-137419135 CTGGACAAACAGGCCTTGCTGGG + Intergenic
1015976036 6:138791815-138791837 TTGGACAAGAATGTCTTTGATGG + Intronic
1016060838 6:139628071-139628093 CTTGAGGAAAATGCCTTAGTTGG - Intergenic
1018151176 6:160940728-160940750 ATGGACAAAAGTGCCTCTGTGGG - Intergenic
1021562870 7:21986396-21986418 CAGGACAAGAAGGCATTTGTGGG - Intergenic
1022596208 7:31715537-31715559 TTGGACAAAAATGCCTTTACAGG - Intergenic
1023214414 7:37846924-37846946 CTGGTCAAAAATCCTTCTGTAGG + Intronic
1023970769 7:44989157-44989179 GGGGACCAGAATGCCTTTGTAGG - Intergenic
1024317109 7:48031222-48031244 CTGGAAAAAAATGTCTATTTAGG - Intergenic
1024778348 7:52815993-52816015 ATAGACAAAACTGCCTTTGTGGG + Intergenic
1025252932 7:57364016-57364038 ATGGACAAAAATTCCTTTGCTGG - Intergenic
1026084191 7:67249351-67249373 GGGGACTAGAATGCCTTTGTAGG - Intergenic
1026692895 7:72564994-72565016 GGGGACTAGAATGCCTTTGTAGG + Intronic
1028061874 7:86329418-86329440 CTATATAAAAATACCTTTGTGGG - Intergenic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1031692761 7:124810817-124810839 AAGAACAAAAATCCCTTTGTAGG - Intergenic
1033627557 7:143125405-143125427 GGGGACAAGATTGCCTTTGTAGG + Intergenic
1034129515 7:148701905-148701927 CTGGAATAAAATGTCTTTGGGGG + Intronic
1037281831 8:17249969-17249991 CTGAACAAACAGGCCTTGGTGGG - Intronic
1037662883 8:20942210-20942232 TTGGACCAAAGTGCCTTGGTTGG - Intergenic
1039338377 8:36619975-36619997 GTGGAGAAAAATCCTTTTGTGGG + Intergenic
1042878182 8:73459361-73459383 CTGGAAAAATATGGCTTTTTTGG - Intronic
1043307068 8:78807706-78807728 CTGGACAGAAAAGCCTTTAAGGG + Intergenic
1044509658 8:93059819-93059841 ATGGACAAGAATACTTTTGTAGG + Intergenic
1045811888 8:106231534-106231556 AAAGACAAAAATGCCTTTGTGGG + Intergenic
1045936017 8:107679826-107679848 CTGAAAACAAAAGCCTTTGTAGG - Intergenic
1046848715 8:118948857-118948879 CTGTAGAATAATGCCTTTGGGGG - Intronic
1047851776 8:128865041-128865063 CTGGACAGACAGGCCTTGGTGGG + Intergenic
1048072350 8:131035384-131035406 CTAGACAATAATCTCTTTGTTGG + Intronic
1051963704 9:22800695-22800717 TGGGAAAAAAGTGCCTTTGTAGG + Intergenic
1052086328 9:24270995-24271017 GTCTACAAAAATGCCTTTGATGG + Intergenic
1052755566 9:32537455-32537477 ATAGACAAAAAAGCATTTGTGGG - Intergenic
1052765695 9:32638335-32638357 CTGGACAAAGAAGTCTATGTTGG + Intergenic
1052836537 9:33254382-33254404 GTTAACAAAAATGCCTTTGAAGG + Exonic
1054914398 9:70482528-70482550 CTGGACAATAAAGTCTTTGAAGG - Intergenic
1056129874 9:83573854-83573876 CTTGACCAAAATCCCTTTCTTGG - Intergenic
1057613136 9:96564897-96564919 CTGAATATAAATGCCTTTTTTGG + Intronic
1058973013 9:110100485-110100507 ATGTACACAAAGGCCTTTGTGGG - Intronic
1060521896 9:124298679-124298701 TTGGACAAATATGCAGTTGTTGG + Intronic
1061221194 9:129253251-129253273 CTGGACAAAGGGGCCTTTGGAGG + Intergenic
1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG + Intronic
1062529757 9:136994636-136994658 CCCGACAAAGATGCCTTTATTGG + Exonic
1186748177 X:12592158-12592180 CTGGACAGACAGGCCTTGGTGGG + Intronic
1186750751 X:12619432-12619454 ATGGACAAAAGTGGCTTTGTGGG + Intronic
1188781037 X:34285470-34285492 CTGTACAAAATTTACTTTGTTGG + Intergenic
1188999764 X:36931356-36931378 TGGGACTAAACTGCCTTTGTAGG - Intergenic
1190443594 X:50500584-50500606 CTGTACAAGCATGCCATTGTGGG + Intergenic
1190512182 X:51184942-51184964 ATGGACAAAAGTCTCTTTGTGGG + Intergenic
1192332665 X:70190360-70190382 ATGGACCAAAGTACCTTTGTGGG + Intronic
1194534847 X:95094022-95094044 ATTGACAAAAGTGTCTTTGTGGG + Intergenic
1196373519 X:115004604-115004626 CTGGAGAAAAATATCTTTTTGGG - Intronic
1197204550 X:123778385-123778407 CTGGTCAAAAAGATCTTTGTGGG - Intergenic
1198804814 X:140483784-140483806 GTGGATAAAAATGCTTTTTTGGG + Intergenic
1199347634 X:146760772-146760794 ATGGACAAAAGTGCCTTTGTAGG + Intergenic
1200290104 X:154863667-154863689 ATGGACAAAAGTGTCTTTGTGGG + Intronic
1200754007 Y:6972940-6972962 TTGGACACAAATCCCTGTGTTGG + Intronic
1200837466 Y:7746915-7746937 CTGGACTCAAATGCCTTTCCTGG - Intergenic
1202059680 Y:20873294-20873316 CTTGTCCAAAATGCCTTTGGAGG + Intergenic