ID: 1061875169

View in Genome Browser
Species Human (GRCh38)
Location 9:133539938-133539960
Sequence GCACCTGGGACCAAACTCGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061875157_1061875169 21 Left 1061875157 9:133539894-133539916 CCACCTTGCAGGGAGCTGACTGA 0: 1
1: 0
2: 1
3: 11
4: 207
Right 1061875169 9:133539938-133539960 GCACCTGGGACCAAACTCGACGG 0: 1
1: 0
2: 0
3: 6
4: 76
1061875158_1061875169 18 Left 1061875158 9:133539897-133539919 CCTTGCAGGGAGCTGACTGAGCT 0: 1
1: 0
2: 2
3: 25
4: 230
Right 1061875169 9:133539938-133539960 GCACCTGGGACCAAACTCGACGG 0: 1
1: 0
2: 0
3: 6
4: 76
1061875156_1061875169 22 Left 1061875156 9:133539893-133539915 CCCACCTTGCAGGGAGCTGACTG 0: 1
1: 0
2: 2
3: 22
4: 206
Right 1061875169 9:133539938-133539960 GCACCTGGGACCAAACTCGACGG 0: 1
1: 0
2: 0
3: 6
4: 76
1061875155_1061875169 30 Left 1061875155 9:133539885-133539907 CCTGGGGACCCACCTTGCAGGGA 0: 1
1: 0
2: 4
3: 27
4: 290
Right 1061875169 9:133539938-133539960 GCACCTGGGACCAAACTCGACGG 0: 1
1: 0
2: 0
3: 6
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061875169 Original CRISPR GCACCTGGGACCAAACTCGA CGG Intronic
901850952 1:12015170-12015192 GCCCCTGGGGCCAGACGCGATGG + Intergenic
911474293 1:98357250-98357272 GAACCTGGGTCCCAACTCCATGG + Intergenic
911537667 1:99119831-99119853 CAACCTGAGACCAAACTAGAAGG - Intergenic
1088439072 11:109848510-109848532 GGTCCTGGGACTACACTCGAAGG + Intergenic
1089457069 11:118631922-118631944 GCACCTAGCACCAAGCTCCAGGG + Exonic
1091970010 12:4779267-4779289 ATATCTGGGACCAAACTCTAGGG - Intronic
1104962800 12:132496111-132496133 GCACCAGGCCCCAAACGCGAAGG - Intronic
1104973194 12:132540700-132540722 GCACCTGGAACCAGGCTCCAGGG + Intronic
1112175421 13:97018673-97018695 GCAGGTGGGACCAAAAGCGATGG + Intergenic
1113209392 13:107957561-107957583 GCCCTTGGGACCAAACTCTGTGG + Intergenic
1117282340 14:54253460-54253482 CCACCTGGGACCAGCCTCAAAGG + Intergenic
1121558619 14:94857561-94857583 GCACCTGAGACAAAATTTGAGGG - Intergenic
1121739912 14:96244195-96244217 ACCCCAGGGACCAAACTCGGGGG - Intronic
1121806982 14:96836398-96836420 GCAGCAGGGAACAAACACGATGG - Intronic
1126880766 15:53094136-53094158 GCCACTGGGAACAAACTGGATGG - Intergenic
1129685685 15:77684988-77685010 GCACCTGGGCCCAGCCTAGAAGG + Intronic
1131234114 15:90681600-90681622 GGAGCTGGAACCACACTCGATGG + Intergenic
1132003602 15:98205411-98205433 GCACCTTGGTCAAAACTCAATGG - Intergenic
1133104039 16:3495304-3495326 CCACCTGGGCCCAAAGCCGAGGG - Intronic
1134766811 16:16766382-16766404 GCACCTGGGACCCAGCTAGATGG + Intergenic
1139476720 16:67206521-67206543 GCACCTGGGACCAGAGCCCAGGG - Intergenic
1140477956 16:75248459-75248481 GCACCCGGGACCCACCTGGAGGG + Intronic
1143399567 17:6635042-6635064 GCACCTAGGACCCAACTTGATGG - Exonic
1149522248 17:57326313-57326335 GCACCTGTGATCAAACCCGCTGG - Intronic
1151822159 17:76502196-76502218 GCAGCTAGGACCGAACTCCAAGG + Intergenic
1152246046 17:79185066-79185088 GCACCTGGGACCATTCTCTCAGG + Intronic
1153973825 18:10249359-10249381 GGTCCTGGAACCAAACTGGAGGG - Intergenic
1157096275 18:44688067-44688089 GCACCTGGGAGCATACTGGTTGG + Intronic
1160041518 18:75349876-75349898 GCAACTGGGAATAAAATCGAGGG - Intergenic
1162199804 19:9011764-9011786 GTACCTGGAGCCAAACTCCATGG + Intergenic
1163511703 19:17739454-17739476 GCAGCTGGGACCAAATCCCATGG + Intergenic
1165990552 19:39809853-39809875 GGACCTGGAACCAACCTCGCAGG + Intergenic
1167119967 19:47511038-47511060 GCACCTGGGACGCAAGGCGATGG - Intronic
1168137460 19:54360853-54360875 GGACCTGGGGACAAGCTCGAGGG + Intronic
926681318 2:15665973-15665995 GCACCAGGAAGCAAACTCTAGGG - Intergenic
927006161 2:18851541-18851563 GCCCATGGGACAAAACTCGATGG + Intergenic
936491779 2:112978456-112978478 ACATCTGGGACGAAACTTGAAGG - Intronic
945045834 2:205781079-205781101 TGACCTGGGACCAAACTTGCCGG + Intronic
946752343 2:222905052-222905074 TCACCTGGGACCTAACAAGATGG - Intronic
947825140 2:233100679-233100701 GGAACTGGGACCAAACCCCAAGG - Intronic
947940122 2:234046776-234046798 CCATCTGGCACCAAACTCCATGG - Intergenic
1179093898 21:38294015-38294037 GCTCCTGTGACCACAGTCGAGGG + Intronic
1185207118 22:49546266-49546288 GCACCTGGGGCCAACTTCTAAGG + Intronic
952497588 3:33929340-33929362 GAAGCTGGGATTAAACTCGAGGG + Intergenic
953217369 3:40931757-40931779 GCACCAGGGACCAATCCTGAAGG + Intergenic
955800915 3:62685643-62685665 GCACCAGGGACCAAACTTCGTGG + Intronic
957770963 3:84691999-84692021 GCACCTGTGACCACAGTCAATGG - Intergenic
959307444 3:104687499-104687521 GCTCCTGGGACCAAACACTTAGG + Intergenic
968264281 3:197350634-197350656 GCAGCATGGACGAAACTCGAGGG - Intergenic
969894160 4:10287389-10287411 GCACCTGGGACCCAACAGTAAGG + Intergenic
969993666 4:11290173-11290195 GCACCTGGCACCCAGCTCCATGG - Intergenic
983645095 4:169981599-169981621 GAACCTTGGCCCAAACTCCAAGG - Intergenic
984734404 4:183097674-183097696 GCATCTGCGGCCAATCTCGAAGG - Intergenic
985679942 5:1250590-1250612 GCACCTGGCACCAACATCGACGG + Intergenic
988073828 5:26326409-26326431 GCTCCTGGCACCAATCTTGAAGG - Intergenic
990264219 5:54058438-54058460 GCAACTGGGACCAAAATAAATGG + Intronic
991085201 5:62642630-62642652 GCAGCTGGGTCCACACTGGAGGG - Intergenic
993809648 5:92459505-92459527 GCATCTGGGAAAAAACTCAAAGG - Intergenic
993815438 5:92538981-92539003 TCACCAGGAACCAAACTGGATGG + Intergenic
995174273 5:109156617-109156639 GCACCTGGGACCAAACCTGGGGG + Intronic
997366171 5:133326601-133326623 GCACCTGGGAGCAAGCTCTGCGG - Intronic
1002142251 5:177149568-177149590 GCACCAGGGACCAAATTCCTGGG + Intronic
1003237930 6:4315411-4315433 GCACCTGCCAGCAAACTCTAAGG - Intergenic
1005870348 6:29970775-29970797 GAACCTGGGACCACCCTTGAGGG - Intergenic
1007198271 6:40082445-40082467 CCACCTGGGACCACTCTCAAGGG + Intergenic
1010558263 6:77313461-77313483 TCACTGGGGACCAAACTAGAGGG - Intergenic
1015119792 6:129688450-129688472 GCACCTGTTAACAAACTCCAAGG + Intronic
1017301841 6:152869633-152869655 GTAGCTGGGACCACACTCGCAGG - Intergenic
1022350904 7:29565628-29565650 GCTCCTGGGACGAAAGTCGATGG + Intronic
1022589348 7:31646382-31646404 GCACCTGGGAGCAGATTCGCAGG + Intronic
1029064342 7:97834235-97834257 GATCCTGGGACCAATCTCCATGG - Intergenic
1031393826 7:121248057-121248079 GCACCTGAAACCTAACTCCAAGG + Intronic
1040351206 8:46570805-46570827 GATCCTGGGACCAATCTCCATGG - Intergenic
1042848327 8:73190593-73190615 GCACCTGGGGCCACACTGGGAGG - Intergenic
1045098336 8:98821366-98821388 GCACCAGGGACCAGTCTCGTGGG - Intronic
1049311148 8:141934603-141934625 GCATCTAGGACAAAACTGGAGGG + Intergenic
1049731199 8:144179419-144179441 TCACCTGGGACCGACCTGGACGG + Intronic
1052783162 9:32801878-32801900 GTACCTGGGACCAGTTTCGATGG + Intergenic
1061875169 9:133539938-133539960 GCACCTGGGACCAAACTCGACGG + Intronic
1189061752 X:37760973-37760995 GCACCTGGAACAAATCTTGAGGG - Intronic
1189601372 X:42630249-42630271 GAACCAGGGCCCAAACTGGAGGG - Intergenic
1197248618 X:124191718-124191740 GCACCTGGGGGTAAACTGGAGGG + Intronic
1198277783 X:135112749-135112771 GCACCTGGAACCCAACCCCAAGG - Intergenic