ID: 1061876343

View in Genome Browser
Species Human (GRCh38)
Location 9:133546117-133546139
Sequence CCTCCCTGCGTCCCCAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061876335_1061876343 17 Left 1061876335 9:133546077-133546099 CCCTTTGGAAGACAGAGTGTCCC No data
Right 1061876343 9:133546117-133546139 CCTCCCTGCGTCCCCAGCCCTGG No data
1061876338_1061876343 -3 Left 1061876338 9:133546097-133546119 CCCGAGCGCCGAATCGGCCTCCT No data
Right 1061876343 9:133546117-133546139 CCTCCCTGCGTCCCCAGCCCTGG No data
1061876336_1061876343 16 Left 1061876336 9:133546078-133546100 CCTTTGGAAGACAGAGTGTCCCG No data
Right 1061876343 9:133546117-133546139 CCTCCCTGCGTCCCCAGCCCTGG No data
1061876339_1061876343 -4 Left 1061876339 9:133546098-133546120 CCGAGCGCCGAATCGGCCTCCTC No data
Right 1061876343 9:133546117-133546139 CCTCCCTGCGTCCCCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061876343 Original CRISPR CCTCCCTGCGTCCCCAGCCC TGG Intronic