ID: 1061877740

View in Genome Browser
Species Human (GRCh38)
Location 9:133553358-133553380
Sequence CCTCGTGTCCTGCAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061877740_1061877744 -7 Left 1061877740 9:133553358-133553380 CCTTCCAGCTGCAGGACACGAGG 0: 1
1: 0
2: 1
3: 24
4: 166
Right 1061877744 9:133553374-133553396 CACGAGGGTGTCTTTCTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061877740 Original CRISPR CCTCGTGTCCTGCAGCTGGA AGG (reversed) Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
900598691 1:3493928-3493950 CCTCCTGTCCTGCACCCAGACGG + Intronic
900652138 1:3734910-3734932 CTTCCTGCCCTTCAGCTGGAAGG - Exonic
901474221 1:9478527-9478549 CCTCCTCTCCTCCATCTGGAAGG + Intergenic
901528052 1:9836342-9836364 GCTTGCCTCCTGCAGCTGGAAGG - Intergenic
901768274 1:11517501-11517523 CATCGTGTCCTGTTGCTGGCTGG + Exonic
902925698 1:19694461-19694483 CCTCCTGTCCTGCAGCAGCACGG + Exonic
904815324 1:33192065-33192087 CCTAATTTCCTACAGCTGGAGGG - Intergenic
906152256 1:43594375-43594397 CCATGTGCCTTGCAGCTGGAAGG - Intronic
906256551 1:44355063-44355085 CGTCGGGGCCTGCACCTGGAGGG - Exonic
913265454 1:117038790-117038812 CCTCTTTTCCTCCAGCAGGAAGG + Intergenic
914912307 1:151797465-151797487 GGTCGTGTCCTGCAACTGAAAGG + Intergenic
922230832 1:223684198-223684220 CCTTGTTACCTGCTGCTGGAAGG - Intergenic
924707967 1:246513452-246513474 CCTCCTGGCCTCCAGCTGGCTGG - Intergenic
1062944509 10:1450330-1450352 CTTCGTTTCCTGCTGCTGGAAGG + Intronic
1067549714 10:47225837-47225859 CCACTTGTCCTGAAGGTGGAGGG + Intergenic
1069917828 10:71798194-71798216 CCTCCTGTGCTGCAGCCTGAGGG + Intronic
1070138768 10:73720341-73720363 CCTCTTGTCTTGTAGCTAGAGGG - Intergenic
1070338793 10:75477944-75477966 TCTCCTGTGCTGCAGCTGAAAGG - Intronic
1072427912 10:95345582-95345604 CCCATTGTCCTGCAGATGGATGG - Intronic
1072618732 10:97066344-97066366 GCTCGGGGCTTGCAGCTGGAAGG + Intronic
1076384774 10:130048232-130048254 CCTGCTGTCCTGCAGCTGTAGGG - Intergenic
1077219197 11:1407964-1407986 CCACCTGCCCTGCAGCTAGAGGG + Intronic
1079347094 11:19662571-19662593 CCACATGTCAGGCAGCTGGAGGG + Intronic
1080590312 11:33717720-33717742 CCTCCTAACCTGCAACTGGAAGG + Intronic
1081549799 11:44100651-44100673 CCGCATCTCCTGCAGCTGGAGGG + Intronic
1082925970 11:58547645-58547667 CCTCGCCTCCTGCAGCTTGAAGG + Intronic
1083314644 11:61806923-61806945 CACCATGGCCTGCAGCTGGATGG + Intronic
1085293966 11:75420330-75420352 CCTAGAGGCCTGCAGCTAGATGG - Intronic
1085466740 11:76729142-76729164 CCTCATGTCCTGTAGGTGCAGGG - Intergenic
1086689229 11:89769774-89769796 TCTCGTGTCCTGTCCCTGGATGG - Intergenic
1086716629 11:90070197-90070219 TCTCGTGTCCTGTCCCTGGATGG + Intergenic
1086744681 11:90410201-90410223 CCTTGTGTCCTGCAAGTGGAGGG + Intergenic
1086938454 11:92769563-92769585 CCTCTTTACCTGCAGATGGATGG + Intronic
1088649408 11:111944146-111944168 CCTCATCTTCTGCTGCTGGAGGG + Intronic
1089416425 11:118296010-118296032 CCTCATCTCCTGCAGCTAGAGGG + Intergenic
1090832245 11:130427864-130427886 CCCCGCGCCCTGCGGCTGGATGG + Exonic
1091219981 11:133924896-133924918 CCACGTGTCCTGCAGCCCCAGGG + Exonic
1091367038 11:135030954-135030976 CCTCATTTCCTGCATTTGGATGG + Intergenic
1091974819 12:4815865-4815887 CCTAGTGTCCTGCTGCAGGTGGG - Intronic
1094361386 12:29634977-29634999 CCTCCTGCCCTGCAGCCTGATGG - Intronic
1095672471 12:44876653-44876675 CCTTGCCTCCTGCAGCTGGGTGG - Exonic
1095977580 12:47950206-47950228 CCCCGTTTCCTGCGCCTGGAGGG - Intergenic
1096571824 12:52527763-52527785 CCACGTCTCATGCATCTGGAAGG - Intergenic
1101853703 12:108424790-108424812 CCTCATCTTCTGTAGCTGGAAGG - Intergenic
1104887820 12:132121456-132121478 CGTCCTGTCCTGCAGCTGCCGGG - Intronic
1105296881 13:19095496-19095518 TCTCCTCTCCTGCAGCAGGAGGG + Intergenic
1107080058 13:36365111-36365133 CCACGTGTCCTGCTGCTGCCAGG + Intronic
1111452850 13:88441545-88441567 CCTTATCTCCTGCAGCTGCAGGG + Intergenic
1114500799 14:23166908-23166930 CCACGTGTCGCTCAGCTGGAGGG - Intronic
1115740197 14:36379289-36379311 TCTCATTTCCTACAGCTGGAGGG - Intergenic
1118064910 14:62180249-62180271 CCTTGTCTTCTGAAGCTGGATGG + Intergenic
1120458656 14:84765269-84765291 TCTAGTGTCCTTCAGCTTGAAGG - Intergenic
1121731802 14:96192643-96192665 CCAGGTGTCCCTCAGCTGGAAGG - Intergenic
1121836278 14:97095458-97095480 CCTCGTCTCCACCTGCTGGATGG + Intergenic
1121858938 14:97298504-97298526 CCCCGAGTCCTGCAGCTAGGGGG - Intergenic
1122305798 14:100765674-100765696 TCTCATCTCCTGCAGCTGGAGGG - Intergenic
1125119108 15:36131914-36131936 CCTAGTGTTCTTCAGCTGGAGGG + Intergenic
1126270823 15:46815060-46815082 CCTTATGTCCTGTAGCTGCAAGG - Intergenic
1126942134 15:53778846-53778868 CCTCCAGTCCTGTAGTTGGAGGG + Intergenic
1128515704 15:68340619-68340641 CCCCTTGTCCTGCAACTGGTGGG - Intronic
1132406085 15:101542604-101542626 CCTAGTGTCCGGCAGGAGGAGGG - Intergenic
1132746502 16:1438474-1438496 CCCCGAGGGCTGCAGCTGGATGG - Intronic
1134100419 16:11447997-11448019 CCTCGGGGCCTGCAGTTGGAAGG - Exonic
1134662733 16:15996583-15996605 CCTCCTGTCCTGGAGTTGGCTGG + Intronic
1136458371 16:30395221-30395243 CCTCCTGGGCTGCAGCTGGGTGG - Exonic
1137384600 16:48030005-48030027 CCCTGTGACCAGCAGCTGGAAGG + Intergenic
1138224458 16:55280876-55280898 CAGGGTGTGCTGCAGCTGGACGG + Intergenic
1138430952 16:56969005-56969027 CCTGGTGTGCTGAAGATGGAGGG - Intronic
1141263663 16:82476147-82476169 CCTCATGCCCTGCAGGTGAAAGG - Intergenic
1144058341 17:11560310-11560332 CCTGGAGTCGTGCGGCTGGAAGG + Exonic
1144548134 17:16215959-16215981 CCTCGTGGCTGGGAGCTGGAGGG + Intronic
1146234601 17:31146540-31146562 TCTCCTCTCCTGCAGCAGGAGGG - Intronic
1146716849 17:35093506-35093528 CCTCATGCCCTGGAGCTGTACGG - Intronic
1148346711 17:46908255-46908277 CCTCATGGCCCGCAGCGGGAAGG + Intergenic
1148940768 17:51209313-51209335 CCTCGCGTCCTGAGTCTGGAAGG - Intronic
1152013613 17:77735603-77735625 CCTCCAGTCCTGCAGGTGGTCGG + Intergenic
1152610705 17:81313882-81313904 CCTCGGGCCCTGCAGCAGGGTGG + Exonic
1155740974 18:29287170-29287192 TTTCATCTCCTGCAGCTGGAGGG - Intergenic
1156482920 18:37447504-37447526 CTTCCTCTCCTGCAGCTGGAGGG + Intronic
1158180772 18:54712964-54712986 CCGCCTCTCCTGCAGGTGGATGG + Intergenic
1159935492 18:74363571-74363593 CATGGTGTCCTGCGGGTGGAGGG - Intergenic
1160983516 19:1827340-1827362 CTTCCTGTCGGGCAGCTGGAGGG + Exonic
1163020219 19:14477605-14477627 CCTGGTGGCCTGCAGCCAGAAGG + Intergenic
1163322238 19:16581596-16581618 CCTCTTGTCTGGCAGCAGGATGG - Intronic
1163402327 19:17101652-17101674 GCGCGTGTCCTGGAGCTAGAAGG - Exonic
1164611602 19:29636335-29636357 CCTCGTGCCCTGCAAGTGGGAGG + Intergenic
1165460190 19:35939750-35939772 CTGCGTGCCCTGCACCTGGATGG + Exonic
1165506910 19:36238827-36238849 CCTCCTGCCATGCAGCTGGGGGG - Intronic
1166837053 19:45673899-45673921 CCTCGTGCCCTGGAGCTGAAGGG + Intronic
1166919976 19:46222610-46222632 TCCCCTGTCCTGCAGCTGCAGGG - Intergenic
1167040669 19:47020992-47021014 CCGAGTCTCCTGCAGCGGGAGGG - Exonic
928965738 2:36973542-36973564 CTTCATGTCCTGCAGCTGAGGGG - Intronic
932270328 2:70403510-70403532 CCTTTTCTTCTGCAGCTGGAAGG + Intergenic
932751349 2:74373615-74373637 CCTCCTTTCCTACAGCTGGGTGG - Intronic
936852930 2:116923230-116923252 CTTCCAGTCCTGCATCTGGAGGG - Intergenic
937536536 2:122895768-122895790 ACTCATGTCCTGCAACTGGATGG + Intergenic
938692758 2:133807539-133807561 TCTGCTGTGCTGCAGCTGGAAGG - Intergenic
939239688 2:139541866-139541888 GCTAGTGTCCAGCAGTTGGAAGG + Intergenic
943212110 2:184980193-184980215 CCTCATCTCCTGCAGCTGCAGGG + Intergenic
943689311 2:190852891-190852913 CCTCATGCCCTGGAGCAGGAGGG + Intergenic
946081186 2:217119898-217119920 CCAAGAGACCTGCAGCTGGAGGG - Intergenic
946411119 2:219515598-219515620 CCAGGTGTCCTGGAGCTGGCTGG + Intronic
947586477 2:231360035-231360057 CCTCTTCTCCTACAGCTGAAGGG - Intronic
948563146 2:238867141-238867163 CCTCGAAGCCAGCAGCTGGAGGG + Intronic
948809466 2:240467312-240467334 CCCCGTGCCCTGCAGCTGGCTGG - Exonic
1170210713 20:13844026-13844048 CCTAGGGTTCTGCTGCTGGATGG - Intergenic
1170226164 20:13994260-13994282 ACTCTTGTCCCCCAGCTGGAGGG - Intronic
1171142928 20:22758550-22758572 CCTTGTGTCCTTCAGCAGAAAGG - Intergenic
1172534648 20:35664177-35664199 CTTCGTGGCCTGAAGGTGGAGGG - Intronic
1173249610 20:41357649-41357671 CCTACTGGCCTGCAGCCGGAGGG + Intronic
1175095776 20:56540525-56540547 CCACGAGTCCTACAGCTGCAAGG - Intergenic
1177095082 21:16822765-16822787 CCTAATCTCCTGTAGCTGGAAGG + Intergenic
1179899291 21:44380704-44380726 CCTCGGGTGCTGCTGCTGGTGGG + Intronic
1180184978 21:46135023-46135045 CCGCGGGTCCCGCAGGTGGAGGG + Intergenic
1180867867 22:19129809-19129831 CCTCCTGTCTTGCACCTGCAGGG + Intergenic
1181173580 22:21023585-21023607 GCTCTTCTCCTGCAGCTGGAAGG - Exonic
1182847927 22:33446774-33446796 CCTGGTGTCATACAGCAGGATGG - Intronic
1184483151 22:44759844-44759866 CCTCACCTCTTGCAGCTGGAGGG + Intronic
1184841979 22:47057384-47057406 CCTGGTTCCCTGCACCTGGAAGG - Intronic
1185251054 22:49801891-49801913 CCACGTGTCCTGCTACTGCAGGG + Intronic
950234417 3:11306316-11306338 CTTAGTGTCCTCCAGCTGGGTGG + Intronic
950634858 3:14307596-14307618 CCCCGTGTCCTGCTGCAGGTGGG - Intergenic
954923992 3:54216613-54216635 CTTCTTGCCCTCCAGCTGGAAGG + Intronic
959289950 3:104460939-104460961 TCTAGTTTCCTGCAGCTAGAGGG - Intergenic
959480372 3:106865173-106865195 CCTCAAGGCCTGCAGCTGCAGGG + Intergenic
962318145 3:134371314-134371336 CCTCAGGGCCTGCTGCTGGATGG + Exonic
963852660 3:150223941-150223963 CTTCATCTCCTGCAGCTGGAAGG + Intergenic
969325437 4:6441367-6441389 GCTCCTCCCCTGCAGCTGGAGGG - Intronic
975845377 4:78519650-78519672 CCTTCTGTCCTGATGCTGGAAGG + Intronic
976407825 4:84679532-84679554 CCTGCTGTGCTGCAGCTAGATGG + Intronic
976824913 4:89249754-89249776 CCCCGAGTTCTGCAGCAGGAAGG - Exonic
977771710 4:100868526-100868548 CCTGCTATGCTGCAGCTGGAAGG - Intronic
978367174 4:107994689-107994711 TCTCATGTCCTTCAGCAGGAAGG - Intronic
981451510 4:144903503-144903525 CCTTGTCTCCTGGTGCTGGAGGG + Intergenic
982260231 4:153488369-153488391 CACCCCGTCCTGCAGCTGGAGGG + Intronic
984680353 4:182601107-182601129 CCAGCTGTCCTGCAGCTGGACGG - Exonic
984950531 4:185004513-185004535 TCCCGTGTCCTGCAGCTGACGGG - Intergenic
985543365 5:497300-497322 CGTCGACTCCTGCACCTGGAGGG - Intronic
985728265 5:1526855-1526877 CCTTCTCTGCTGCAGCTGGAAGG + Intergenic
985999629 5:3620310-3620332 CCTCGTGACCTGTAGCAGGCAGG - Intergenic
991256689 5:64622052-64622074 CCTCATCTTCTGTAGCTGGAGGG - Intergenic
994115112 5:96053001-96053023 GCTCTAGTCCTGCAGTTGGAAGG + Intergenic
995463889 5:112430980-112431002 CTTGTTTTCCTGCAGCTGGATGG + Intergenic
999128026 5:149260952-149260974 TCTCTTTACCTGCAGCTGGAAGG - Intergenic
999274359 5:150319163-150319185 CCTCCTGGAATGCAGCTGGAGGG - Intronic
999535026 5:152506648-152506670 CCTCATCTCCTGCAGCTAGAGGG - Intergenic
1001043309 5:168352503-168352525 CCTTAGGTCCTGCAGCTGGAAGG - Intronic
1001073674 5:168607836-168607858 CCTCATCGCCTGCAGCTAGAGGG - Intergenic
1002105883 5:176879296-176879318 CCTTGTGTCCTGGAGGTGGGAGG - Exonic
1002288953 5:178186716-178186738 GCTTGTATGCTGCAGCTGGATGG - Intergenic
1003327649 6:5104900-5104922 TCACGTGTCCTACAGATGGAAGG - Intronic
1003838839 6:10099319-10099341 CCTCGGGCCTTGCAGCTGGCTGG + Intronic
1004281157 6:14280946-14280968 CCCCGTGTCCTGCAGGTGGCAGG - Intergenic
1004839460 6:19566358-19566380 CCTCATGTCCTCCTGCTGCATGG - Intergenic
1007636742 6:43304178-43304200 CCTCGTCTCTGGCAGCAGGAGGG - Exonic
1014052256 6:116968529-116968551 CCTTGTGTCCTGCAGGAAGAAGG + Intergenic
1014787876 6:125638803-125638825 CCTAATCTCTTGCAGCTGGAGGG - Intergenic
1016473139 6:144396789-144396811 CCTCATGACATGCAGTTGGATGG - Intronic
1017801986 6:157905130-157905152 AGATGTGTCCTGCAGCTGGATGG - Intronic
1019479623 7:1260451-1260473 CCACGTGTTCTGAGGCTGGATGG + Intergenic
1019707248 7:2502583-2502605 CTGCGGGTCCTGCAGCTAGAGGG + Intergenic
1019927990 7:4205924-4205946 CCACGTGACCTCCAGCTGGCTGG - Exonic
1022258925 7:28685474-28685496 CCTTTTTTCCTGGAGCTGGATGG - Intronic
1023644329 7:42293523-42293545 CCTCCTGTGCTGCATCTAGATGG + Intergenic
1026365335 7:69643068-69643090 CCTCTAGTCCTCCAGCTGCAAGG - Intronic
1030388925 7:108901342-108901364 CCTCTTGTCCTTTAGATGGAAGG - Intergenic
1034685312 7:152966037-152966059 CTTCTTTTCCTGCAGCTGGATGG + Intergenic
1035096084 7:156356905-156356927 CAGAGTGTGCTGCAGCTGGATGG + Intergenic
1035192555 7:157184035-157184057 CCCCGTGCCCTGCATCTGGGGGG + Intronic
1036738792 8:11343152-11343174 CCTCTACTCCTGCAACTGGAAGG + Intergenic
1037694424 8:21210946-21210968 CCTCCTGTTCTGCTGCCGGAGGG + Intergenic
1037740344 8:21603974-21603996 CCTCGTCTCCTCCAGCTGAGAGG + Intergenic
1039221768 8:35339609-35339631 CCTTGTGTGCTGCTGCTGCATGG + Intronic
1039854203 8:41398457-41398479 CCTTGTGTCCTGCTGCTTCAAGG - Intergenic
1045932265 8:107641157-107641179 GTTCTAGTCCTGCAGCTGGAAGG + Intergenic
1046271161 8:111899213-111899235 TCTCGTGTGCAGCAGCAGGATGG - Intergenic
1048707097 8:137165983-137166005 TCTCATCTCCTGCAGCTGTATGG + Intergenic
1048880636 8:138869741-138869763 CCTGGTGACCTGCAGCTGGAGGG + Intronic
1049443328 8:142619027-142619049 CCTGGTGTCCTCCAGCTGCCTGG - Intergenic
1050293537 9:4181226-4181248 CCTAGTGTCCAGCAGATGGGTGG - Intronic
1051454291 9:17236227-17236249 CCTCTTTTCATGCAGGTGGATGG - Intronic
1055401525 9:75929559-75929581 CCTCCCCTACTGCAGCTGGAGGG - Intronic
1059466312 9:114470837-114470859 CTTCATGTCCTGGAGCTGGAAGG - Intronic
1061877740 9:133553358-133553380 CCTCGTGTCCTGCAGCTGGAAGG - Intronic
1062394130 9:136345915-136345937 CCTCGGGTGGTGCAGCTTGAAGG - Intronic
1188482897 X:30653116-30653138 CCCCATGCCATGCAGCTGGATGG + Intergenic
1188621842 X:32235176-32235198 CTTCCTTTCCTGCAGCTAGATGG + Intronic
1189492951 X:41483825-41483847 CCACGTGACCTGCTACTGGATGG - Intergenic
1192198413 X:69047862-69047884 CCACCTCTCCTGCAGCTGGTGGG - Intergenic
1196883757 X:120223822-120223844 GCCCGTGTCCTGCACCTGGGAGG + Intergenic
1199198177 X:145057015-145057037 TCTCATCTCCTGCAGCTGAAGGG + Intergenic