ID: 1061878471

View in Genome Browser
Species Human (GRCh38)
Location 9:133556673-133556695
Sequence TGCCCAGGTGTCCCCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 1, 2: 2, 3: 21, 4: 270}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061878471_1061878477 12 Left 1061878471 9:133556673-133556695 CCATGTCTGGGGACACCTGGGCA 0: 1
1: 1
2: 2
3: 21
4: 270
Right 1061878477 9:133556708-133556730 GTTGTCTGGACAGTCACAGCTGG No data
1061878471_1061878479 14 Left 1061878471 9:133556673-133556695 CCATGTCTGGGGACACCTGGGCA 0: 1
1: 1
2: 2
3: 21
4: 270
Right 1061878479 9:133556710-133556732 TGTCTGGACAGTCACAGCTGGGG No data
1061878471_1061878480 22 Left 1061878471 9:133556673-133556695 CCATGTCTGGGGACACCTGGGCA 0: 1
1: 1
2: 2
3: 21
4: 270
Right 1061878480 9:133556718-133556740 CAGTCACAGCTGGGGACGCCTGG No data
1061878471_1061878478 13 Left 1061878471 9:133556673-133556695 CCATGTCTGGGGACACCTGGGCA 0: 1
1: 1
2: 2
3: 21
4: 270
Right 1061878478 9:133556709-133556731 TTGTCTGGACAGTCACAGCTGGG No data
1061878471_1061878481 23 Left 1061878471 9:133556673-133556695 CCATGTCTGGGGACACCTGGGCA 0: 1
1: 1
2: 2
3: 21
4: 270
Right 1061878481 9:133556719-133556741 AGTCACAGCTGGGGACGCCTGGG No data
1061878471_1061878473 -10 Left 1061878471 9:133556673-133556695 CCATGTCTGGGGACACCTGGGCA 0: 1
1: 1
2: 2
3: 21
4: 270
Right 1061878473 9:133556686-133556708 CACCTGGGCAGTCACAGCCAGGG No data
1061878471_1061878475 -2 Left 1061878471 9:133556673-133556695 CCATGTCTGGGGACACCTGGGCA 0: 1
1: 1
2: 2
3: 21
4: 270
Right 1061878475 9:133556694-133556716 CAGTCACAGCCAGGGTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061878471 Original CRISPR TGCCCAGGTGTCCCCAGACA TGG (reversed) Intronic
900558345 1:3291231-3291253 GGCCCAGGAGACCCCAGTCAGGG + Intronic
900658158 1:3770335-3770357 TGACCAGGGGTCCCCAAGCAAGG + Intronic
900709864 1:4106993-4107015 GGCCCAGGTATCCCCTGAGATGG + Intergenic
900940469 1:5795387-5795409 TGACCAGCTGTCCCCAAAGATGG + Intergenic
902728691 1:18354138-18354160 TTCCCAGGTTTTTCCAGACAGGG - Intronic
905172849 1:36119343-36119365 TGCCCAAGTTCCCCCAGCCAGGG + Intronic
905360133 1:37413374-37413396 TGCCCAGGAGTCCTCTGGCAGGG - Intergenic
905485390 1:38292434-38292456 TGCCCAGGGCTCCCCAGGCTGGG - Intergenic
905557521 1:38899251-38899273 GGCCCAGGTACCCCCAGAGAAGG + Intronic
905982525 1:42242638-42242660 TGCCCAGGTGACCAAGGACACGG + Intronic
906153209 1:43599799-43599821 TTCCTAGGGGTCCACAGACATGG - Intronic
907313513 1:53553279-53553301 TGCCCAGGTGCACCCAGTCTTGG + Intronic
909935557 1:81546539-81546561 TGCCCAGATGTGCCAAGAAATGG + Intronic
910765511 1:90778523-90778545 TGCCCAGGTATAACCAGATAAGG + Intergenic
912420609 1:109540010-109540032 TGCCAAGGTATCCCCACAGAAGG + Intronic
912491431 1:110064831-110064853 TGCCGAGGGGGCCCCAGAGACGG - Exonic
912763819 1:112391063-112391085 TGCCCGAGTCTCCCCAGATAGGG + Intergenic
917740541 1:177958178-177958200 TGCGCAGGTGTCTCCACACTGGG + Exonic
918309116 1:183272920-183272942 TGCCCTTCTGTCCCCAGTCATGG + Intronic
919937823 1:202266259-202266281 TGTCCCTGTGTCCCCAGGCAGGG - Intronic
922584756 1:226725260-226725282 AGCACAGGTGTCTGCAGACAAGG + Intronic
923091545 1:230744924-230744946 TGCCGAGGTGTCACCAGAAATGG + Intergenic
923683892 1:236141432-236141454 TCCCCAGCTCTCCCAAGACAAGG + Intergenic
1063129419 10:3165020-3165042 ATACCAGGGGTCCCCAGACATGG + Intronic
1063877541 10:10495738-10495760 TGCCCAGGTCTCCCTGGGCACGG - Intergenic
1065792797 10:29276970-29276992 TGTCCTTGTGTCTCCAGACAGGG + Intergenic
1069609743 10:69764982-69765004 CGACCAGGTGTCCACACACAGGG + Intergenic
1070309654 10:75264028-75264050 TGCCCAGCTGGCCCCAGCAATGG - Intergenic
1070606392 10:77901433-77901455 TGCTCAGGTGCACCCAGCCAAGG - Intronic
1071564157 10:86663013-86663035 TGTCCAGGTGTGCCCAGGGATGG + Intronic
1072265341 10:93721804-93721826 TTCCCAGGAGTGCCCAGACATGG + Intergenic
1072732221 10:97853867-97853889 TGCCCAAGGGGCCCCAGCCATGG + Intronic
1074424775 10:113341511-113341533 TATCCCTGTGTCCCCAGACATGG + Intergenic
1075641742 10:124069712-124069734 TGCCCAGGTGTCCTATGGCAGGG - Intronic
1075762379 10:124866488-124866510 TGCCCAGGTACCCCCCGATAGGG + Intergenic
1076372605 10:129964840-129964862 TGCCCAGGGCTCCCCGGCCAAGG + Intergenic
1076781225 10:132725679-132725701 TGCACAGCTGTCCACAGGCAGGG - Intronic
1077239570 11:1503452-1503474 TGTCCAGGTGACCGCACACATGG + Intergenic
1078590470 11:12636852-12636874 AGAGCTGGTGTCCCCAGACAGGG + Intergenic
1079157405 11:17961043-17961065 TCCCCAGCTCTCCCCAGAAAGGG + Intronic
1079814761 11:25041747-25041769 AGCGCAGGGGTCCCCAGCCATGG + Intronic
1079986013 11:27201631-27201653 TGCCCAGGTGTCACTGGAGAGGG + Intergenic
1081636678 11:44726748-44726770 GGCCCAGGGACCCCCAGACAAGG + Intronic
1089708347 11:120297283-120297305 TTCCCAGGTGTCCCAGGGCAGGG - Intronic
1090079576 11:123603009-123603031 TGCCCAGAGGTCCCCTGACCCGG - Intronic
1090717424 11:129442608-129442630 GGCCCAGGTGTCCTCAGGCATGG + Intronic
1090840977 11:130487269-130487291 GGCTCAGGCGTCCCCAGGCAAGG - Intergenic
1090876038 11:130789740-130789762 AGCCCAGGTGACCCCATGCAGGG - Intergenic
1091306492 11:134539505-134539527 TTCCCAGGTGGCCCCAAGCATGG + Intergenic
1094594965 12:31856885-31856907 TTCCCAGGTGTCCCTGGACCTGG + Intergenic
1096499997 12:52058946-52058968 TGCACACGTGTTCCCAGGCAGGG - Exonic
1098953442 12:76665176-76665198 CTCCCATGTGTCCCCAAACAAGG + Intergenic
1102505837 12:113384214-113384236 TGCCCAGGTGGCCCCATCCGAGG - Exonic
1102543721 12:113639891-113639913 TGCTCAGGTGACCTCAGCCAGGG + Intergenic
1102808827 12:115806085-115806107 TGGCCACGTGTCCCTAGAAATGG + Intergenic
1104016465 12:124965364-124965386 TGCCCTGCTGTGCCCAGCCAGGG - Intronic
1104929687 12:132331782-132331804 TGCAAAGGTTTCACCAGACATGG + Intergenic
1104949789 12:132434230-132434252 GGCCCTGGTGACCCCAGGCATGG - Intergenic
1105646214 13:22320601-22320623 TGACCAGGTGCCCTCAGACTGGG - Intergenic
1106347102 13:28889669-28889691 TGTCCATGTTTCCCCAGGCATGG - Intronic
1106733002 13:32561281-32561303 TGTCCAGGTGTTACCAGAAAGGG - Intergenic
1107309298 13:39060067-39060089 TGCCCAGGTGTCACCACACCAGG + Intergenic
1107731735 13:43355866-43355888 TCCACAGGGATCCCCAGACACGG - Intronic
1107994583 13:45847898-45847920 TGCCCAGGTTTTTCCAGAGAAGG - Intronic
1108593929 13:51934581-51934603 AGCCCAGCTGCACCCAGACAAGG + Exonic
1112339457 13:98540938-98540960 TCCCCAGGCCTCCACAGACAAGG + Intronic
1113849808 13:113411718-113411740 TGCTGAGGTGTCCTCAGCCATGG + Intergenic
1114167769 14:20239247-20239269 TTCCCAGGTGTCCTGAGAGAAGG - Intergenic
1115646177 14:35369730-35369752 TGCCCAGGTGCCCCCGCACCCGG - Intergenic
1122045724 14:99021820-99021842 TTACCAGGTGTCCCCTGAGAAGG + Intergenic
1122169377 14:99859558-99859580 TAGCCAGGTGTCCACAGGCAAGG - Intronic
1122871577 14:104641225-104641247 CGCCCAGGTATCCCCTGAGAAGG + Intergenic
1127510223 15:59633475-59633497 TGCCCATGTGTCTCCAGAAGTGG + Intronic
1128495394 15:68195531-68195553 TACTCAGGTGTCCTCAGACTTGG - Intronic
1128567317 15:68710023-68710045 AGACCACGTGGCCCCAGACAGGG - Intronic
1129720169 15:77873505-77873527 GCCCCAGCTGTCACCAGACAGGG - Intergenic
1132143126 15:99410850-99410872 CGCCCAGATGTCCAGAGACAAGG - Intergenic
1132228198 15:100160344-100160366 TGCCCAGGAGATCCCAGCCAGGG - Intronic
1132687508 16:1168500-1168522 TGCCCAGGTCACCCCAGAGCTGG + Intronic
1133036772 16:3037980-3038002 TGACCAGGGGACCCCAAACAAGG - Intergenic
1133767240 16:8846603-8846625 TGCCCAGGTCCTCCTAGACATGG + Intronic
1134624262 16:15712785-15712807 TGGCCAGAGGTCCCCTGACAGGG - Intronic
1135493255 16:22928828-22928850 TTCCCTGGTGTCACCATACATGG - Intergenic
1136067754 16:27770199-27770221 AACCCAAATGTCCCCAGACAAGG - Intronic
1136552958 16:30991224-30991246 GGCCGAGGTGGCCCCAGGCAGGG - Exonic
1137023437 16:35452144-35452166 TCCCCAGGTGTCCCCAGAGGGGG + Intergenic
1137580792 16:49632400-49632422 TCCCCAGGTGTGCCCACACAGGG + Intronic
1138322338 16:56126380-56126402 TGCCCAGGATTCCCCAACCAAGG + Intergenic
1138442010 16:57040882-57040904 TGCCCAGCCCACCCCAGACAGGG + Intronic
1139531631 16:67545415-67545437 TGCCCAGAAGGCCCCAGCCAGGG + Exonic
1139956977 16:70697834-70697856 GCCCCAGATGCCCCCAGACATGG + Intronic
1141859719 16:86708365-86708387 GGCCCAGGTGTGTCCAGACTCGG + Intergenic
1142065623 16:88060757-88060779 TGCTCAGGTGTCCCCAGGAAAGG - Intronic
1142226655 16:88880909-88880931 GGCCCAGGTGCCCTCGGACAAGG + Intronic
1145257872 17:21337483-21337505 GGCCCAGGAGACCCCAGAGAGGG - Intergenic
1150579145 17:66456510-66456532 TGCCCAGGTGTTCTCAGCCGTGG + Intronic
1151340543 17:73468044-73468066 GCTCCAGGTGCCCCCAGACATGG - Intronic
1151756794 17:76079871-76079893 TGCCCTTGTGTCCCCAGTCCTGG + Exonic
1152029387 17:77832291-77832313 AGCCCAGGGGTCCCCAGCCCCGG + Intergenic
1152077902 17:78169926-78169948 TGGCCAGCTGTCTCCACACAAGG - Intronic
1152099894 17:78294830-78294852 CGCCCAGGGGTCACCAGCCAGGG - Intergenic
1152136406 17:78506553-78506575 TGCCCTGGGGTCCCCAGCCATGG - Intronic
1152445098 17:80337826-80337848 TTCACAGATTTCCCCAGACACGG + Exonic
1152633947 17:81422932-81422954 TGCCCCAGTGTCCCCAAGCAGGG + Intronic
1152907526 17:82977010-82977032 GCCCCAGGTGGCCCCAGGCAGGG + Intronic
1152959899 18:73389-73411 TCCCCAGGTGTCCCAAGCCCCGG + Intronic
1154169993 18:12044542-12044564 AGCCCAGGTGTCCCCATGAAGGG - Intergenic
1157094484 18:44675137-44675159 TGCATAGGTGTCCCTAAACAAGG - Intergenic
1157710236 18:49845037-49845059 TGCTCAGGTGGCCCCAGGAAAGG - Intronic
1157808626 18:50677481-50677503 GGCCCAGGAGTCCACGGACAGGG + Intronic
1159851971 18:73535300-73535322 TCCCCACGTGTGCCCAGGCATGG - Intergenic
1160131871 18:76232457-76232479 TGTCCCGGTGTGCCCAGAAAAGG + Intergenic
1160144959 18:76356248-76356270 TGCAAAGCTCTCCCCAGACACGG + Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161222362 19:3123480-3123502 TGCCCACGTGGCCCCACACGTGG - Exonic
1161273912 19:3404885-3404907 TCCCCAGGGGTCCCCAGAGGCGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161429252 19:4221833-4221855 TGCCCAGATGGCCCCAGCCCAGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161501890 19:4620781-4620803 TGCCCAGGGGTGCACAGACTTGG + Intergenic
1161627864 19:5337634-5337656 TGCCTGGGTTTCCCCAGACCTGG - Intronic
1161895470 19:7076278-7076300 TGCTCAGGTTTCCCCAGCCCTGG + Intronic
1162174501 19:8821387-8821409 TGCTCAGGTTTCCCCAGCCCTGG - Intronic
1162402475 19:10454345-10454367 GACCCAAGTGTTCCCAGACATGG - Intronic
1163033651 19:14559956-14559978 TGCCCAGGTGGCCCTAGCCTTGG + Intronic
1163232228 19:16012667-16012689 TGACCAGGTCACCACAGACAAGG - Intergenic
1163597354 19:18227784-18227806 AGTCTTGGTGTCCCCAGACATGG + Intronic
1163688463 19:18725498-18725520 TGGCCAGCCGTCCCCACACACGG + Intronic
1163962662 19:20711838-20711860 TGACCAGGTGTCCCTTGACATGG + Intronic
1164229278 19:23273858-23273880 TGCCCAGGGAGCTCCAGACACGG + Intergenic
1164280380 19:23763330-23763352 TGCTCAGGGGGCTCCAGACATGG - Intronic
1164551804 19:29218342-29218364 TGCCCAGGTGACTCCAGCAATGG - Intergenic
1165081604 19:33310141-33310163 GGGCCAGGGGCCCCCAGACAAGG - Intergenic
1165266041 19:34664435-34664457 TGCCCTGGTGTCCCTGGGCAGGG - Intronic
1165322386 19:35094085-35094107 AGCCCAGGTGGACCCAAACAGGG - Intergenic
1167580182 19:50336791-50336813 GGTCCAGATGTCCCCAGACCTGG - Intronic
1168234534 19:55053754-55053776 TGCCCAGGTGTGTCCAGCCGGGG + Intronic
925340398 2:3131724-3131746 GGCCCCTGTCTCCCCAGACACGG - Intergenic
925452626 2:3982916-3982938 TGCCCAGGTGTCCTGAGATAGGG + Intergenic
926111469 2:10186969-10186991 TGCCCAGGAGTCCCCCGAAGGGG + Intronic
928620757 2:33085381-33085403 TGCCCAGATGTGTCCAGAGAAGG - Intronic
928745668 2:34411596-34411618 AGCCCATGTGGCCCCAGAGAAGG + Intergenic
929927920 2:46230706-46230728 TGCCCAGATGTTCCCAAACCAGG + Intergenic
931751304 2:65332601-65332623 TGCACAGGTGTCCCCTTAGAAGG - Intronic
931753797 2:65353927-65353949 TGCCCAGCTGTCCTTAGTCAAGG + Intronic
934777905 2:96950578-96950600 GACCCACCTGTCCCCAGACAGGG + Intronic
935498988 2:103815346-103815368 TGCCCAGGTCTGCCCTGACTTGG - Intergenic
937360473 2:121225889-121225911 TGCCACGGTGTCCACACACACGG + Intronic
937906555 2:127055468-127055490 TGCCCTGGGTTCCCCAGACAGGG - Intronic
942051626 2:172146154-172146176 TTCACAGGTGTTTCCAGACATGG + Intergenic
942081064 2:172399875-172399897 TATCCTGGTGTCCCCAAACATGG + Intergenic
946640885 2:221782457-221782479 TGACCATGGGTCCACAGACAGGG + Intergenic
947521577 2:230849950-230849972 TGCCGAGGGGCCCCCAGACCTGG + Intergenic
947542202 2:230987028-230987050 TGACTTGGTGTCCCAAGACAGGG + Intergenic
948455876 2:238104435-238104457 GACCCAGGAGTCCCCAGAAAAGG + Intronic
948578720 2:238970193-238970215 TGCCTAGGTGTCCACCCACAAGG - Intergenic
948793082 2:240389110-240389132 GGGCCAGGTGTCCCCAGGCCGGG + Intergenic
1169512641 20:6280948-6280970 TCCCCAGGTCTTACCAGACAAGG - Intergenic
1170425388 20:16230150-16230172 TTCCCAGGTGTCCCAAGTAAAGG + Intergenic
1170625342 20:18025958-18025980 TGGACAGGTGTGCCCAGAAATGG + Intronic
1171012733 20:21517321-21517343 TGCCCAGCTGCCCCCAGGCCAGG - Intergenic
1171440899 20:25162104-25162126 TGCCCCCATGTCCCCAGACGGGG + Intergenic
1172217109 20:33243474-33243496 TTCCCAGGTGTCCTTAGAAAGGG + Intergenic
1174355391 20:49994336-49994358 AGCCCAGATGTGCCCAGAGATGG - Intergenic
1175248959 20:57597420-57597442 TGCCCAGTGGTGCCCAGACCTGG - Intergenic
1175449593 20:59051789-59051811 TGCCCTGGTCTCCCTAGACGTGG - Intergenic
1175838021 20:62008657-62008679 TTCCCAGGTGTCCGCAGTCCCGG - Intronic
1176142532 20:63551140-63551162 TGCCCTGGTGGCCACAAACAGGG + Intronic
1178695111 21:34786012-34786034 TGTCCTGGTGTCCTCAGCCAAGG + Intergenic
1179567119 21:42256132-42256154 CGCCCAGGTTTCACAAGACAGGG - Intronic
1179981154 21:44896648-44896670 GGCCCAGCTCTCCCAAGACAGGG - Intronic
1180065650 21:45410923-45410945 TGCCCAGGTGTGTCCAGACGAGG - Intronic
1180947394 22:19704084-19704106 TGGCCAGGTGTCCTCAGACCGGG + Intergenic
1181026935 22:20132063-20132085 TGCCCGCGTGCCCCCAGACGCGG - Intronic
1181027002 22:20132260-20132282 CGCACTGGTGTCCCCACACAAGG - Intronic
1181604236 22:23970812-23970834 AGCCCAGGGGTCCCCAGGCTGGG - Intronic
1181876939 22:25946888-25946910 TGTCCATGTGTCCCCATTCAGGG - Intronic
1183121502 22:35733392-35733414 TGCCCAGCTGGTCTCAGACACGG + Intergenic
1183200056 22:36379842-36379864 CGGGCAGGTGTCCCCAGAGAAGG - Intronic
1183289989 22:36995275-36995297 TGTCCAGGTGAGCCCAGCCAAGG + Intronic
1183491692 22:38120399-38120421 TGCCCAGGTGGTCTCAGAGAAGG + Intronic
1184090864 22:42292387-42292409 TGCCCTGCAGTCCCCAAACATGG + Intronic
1184645697 22:45893435-45893457 GTCCCAGCTGTCCCCAGCCAGGG - Intergenic
1185281583 22:49972128-49972150 TGCCCCGAGGTCCCCAGAGACGG - Intergenic
1185295169 22:50049589-50049611 GGCCCAGGTGTCCCCAGGTGTGG + Intronic
949102809 3:166201-166223 TGCCTATTTATCCCCAGACAGGG - Intergenic
951865383 3:27301129-27301151 AGGCCAGGTGCCCCCAGGCAGGG + Intronic
951994006 3:28706745-28706767 TGCCCAGGAGTAACCAAACAAGG - Intergenic
952943359 3:38459645-38459667 TGCCCTGGTGTCCCCGGCCTGGG - Intronic
953536723 3:43782587-43782609 TGTCCAGGTGTCCCCAGGCAGGG - Intergenic
953655347 3:44847465-44847487 GGCCCTGGTGTCCACATACACGG + Intronic
957001658 3:74893510-74893532 TTCACAGGTGTGCACAGACATGG + Intergenic
960683164 3:120270214-120270236 TGCCCTGGTCTCCCCAGACATGG + Intronic
961319288 3:126061738-126061760 TGGCCAGGTGTCCTCAGTCACGG - Intronic
961513627 3:127419708-127419730 TTCCCATGGGTCCCCAGAAAAGG + Intergenic
961643865 3:128382043-128382065 TTCCCAGGTGGCCCCAGGCAAGG + Intronic
962851404 3:139310938-139310960 TGGCCATGTGACCTCAGACAAGG - Intronic
963923259 3:150925684-150925706 TGTCCAGGTGGACCCAGCCAAGG - Intronic
964251543 3:154723743-154723765 TGCCCAGCTGTCTACACACAGGG - Intergenic
966871375 3:184292258-184292280 TGGCCAGCTGTCACCAGACCTGG + Exonic
968112913 3:196064318-196064340 TGCCCAGATGTTCTCAGATATGG - Exonic
968377667 4:57013-57035 TGCCCAGGATTCACAAGACAGGG + Intronic
968393968 4:216026-216048 TGCCTAGGAGTCACAAGACAGGG + Intergenic
968552170 4:1229381-1229403 TGTCCTGGTGTCCTCAGCCACGG - Intronic
968674162 4:1868511-1868533 TTCCCAGGCGTCCCATGACAAGG + Intergenic
968818723 4:2834791-2834813 TACCCAGCTGTCCCCAGACTGGG - Exonic
969606829 4:8206038-8206060 AGCCCTGGAGTCCCAAGACAGGG - Intronic
971157355 4:24097317-24097339 AGCCAAGGAGTCCCCAGGCATGG + Intergenic
972950267 4:44313096-44313118 TGCCCTGCTGTGCCCAGAGAAGG + Intronic
974635860 4:64563472-64563494 TGCCCAGGGTCCCCCAGAAAAGG - Intergenic
974844859 4:67340053-67340075 AGCCCAGATGTCCCCACAGATGG + Intergenic
981340212 4:143613374-143613396 TGCATAGGTTTCCCCAGAGAAGG - Intronic
983222063 4:165053110-165053132 TTCCCAGGTGTCCCCAAGGAGGG + Intergenic
983686561 4:170416577-170416599 TGGCCAGGAGTCCCAGGACAAGG - Intergenic
985894431 5:2740148-2740170 TGCCCCGGCGGCCCCAGACCCGG - Intergenic
985948206 5:3202773-3202795 GGGCCACGTGTCCCGAGACAAGG - Intergenic
987798897 5:22667366-22667388 TGTCCAGCTCTCCACAGACAGGG + Intronic
991457644 5:66821934-66821956 GGACCAGGTGTCCCCAGTGAGGG + Intronic
994163106 5:96579256-96579278 TGCCCTGGTGTCCCTGGGCAGGG + Intronic
995527573 5:113062787-113062809 GGCCCAGGTGTCCCAGGAGAGGG - Intronic
996749043 5:126870981-126871003 TGCCCATGTGTCCACACATAGGG - Intronic
997438322 5:133891104-133891126 TGCCCAGAGGGCCCCAAACATGG + Intergenic
997897865 5:137736015-137736037 TGCCCAGGCATCCCCAGCCCAGG + Exonic
998204402 5:140148660-140148682 TGCCCGGGTATCCTCAGAGAGGG - Intergenic
999205674 5:149846263-149846285 TTCCGTGGTGACCCCAGACAAGG + Intronic
1001288129 5:170438349-170438371 TGCCCTGCTGTCCCCACACGAGG - Intronic
1002093346 5:176817372-176817394 GCCCTAGGTGTCCCCAGCCAGGG + Intronic
1002127860 5:177060230-177060252 TACCCAGGTGTGGCCAGGCACGG + Intronic
1002283562 5:178147642-178147664 TGCCCACGATTCCCCAGACCAGG - Intronic
1002443564 5:179276452-179276474 TGGCCAGGTGACCTCAGGCAAGG + Intronic
1007077981 6:39079861-39079883 TCCCCAGGTGTCCCAATACCTGG + Intronic
1007180520 6:39926159-39926181 TGCCCAGGTGCCCTCAGCCCAGG - Intronic
1007473902 6:42106843-42106865 CTCCCAGGTCTACCCAGACAGGG - Exonic
1007633138 6:43283730-43283752 TTCCCGGGGGGCCCCAGACAGGG - Exonic
1011460550 6:87598870-87598892 TGCCCAAGTGTCTTCAGTCAGGG - Intronic
1011965133 6:93147168-93147190 TGCCCAGGAGACCCTAAACATGG + Intergenic
1015552184 6:134423169-134423191 TGCCCTGTCTTCCCCAGACATGG - Intergenic
1018071500 6:160167983-160168005 TCCCCTGGTGTCCCCAGAGCAGG - Intergenic
1018231727 6:161682135-161682157 TGGCCAGGTGTCCACAGGGAGGG + Intronic
1018482088 6:164201161-164201183 TGCCCAGGAGTCACTAGCCAAGG - Intergenic
1019481740 7:1270145-1270167 TGCCCAGGTCGCCCCAGACTGGG - Intergenic
1023856085 7:44185274-44185296 GGGCCAGGTGTCCCAACACAGGG + Intronic
1024342629 7:48282753-48282775 AGGCCATGTGACCCCAGACAGGG - Intronic
1024548919 7:50544185-50544207 TGCCCAGGTGTCCCTACCCACGG - Intronic
1028613188 7:92734932-92734954 TGCCCAGGGGTCAAGAGACATGG + Intronic
1030371244 7:108701694-108701716 TGCCCAGATATCCCCATACTTGG - Intergenic
1031335488 7:120525569-120525591 TCCCCAGGTGGCCACAGACTTGG + Intronic
1032791613 7:135246754-135246776 AGCCCTGGTGTCCCCAGGCGAGG - Intronic
1033033308 7:137847091-137847113 TGCCCTGGCGTCCCCAGCCCGGG - Intronic
1033284088 7:140026061-140026083 TGCCCAGGTACCACCACACATGG + Intronic
1034461356 7:151199656-151199678 TGCCAAGATGTCACCAGACCTGG + Intronic
1034682188 7:152937352-152937374 TGCCCAGGTCTCCCAGGAGATGG - Intergenic
1034897376 7:154886161-154886183 TGCACAGGTGTTACCAGATAAGG + Intronic
1035274520 7:157739654-157739676 TCCCCAGGTGTGACCAGACAAGG + Intronic
1035376597 7:158410867-158410889 TGCCCAGGTGACCCCAGACACGG + Intronic
1035376625 7:158410961-158410983 CACCCAGGTGACCCCAGACATGG + Intronic
1036638373 8:10566706-10566728 TGCCCAGCTGTCCCACCACAAGG + Intergenic
1037084559 8:14832395-14832417 TGCCCAGGTGGTCCAAGACCAGG + Intronic
1037752717 8:21693047-21693069 GGCCCAGGGGTCCCCTGGCAGGG - Exonic
1037949344 8:23008661-23008683 TCCCCATGTGACCCCAGCCATGG - Intronic
1039777408 8:40750768-40750790 TGGCCAGGAATCTCCAGACATGG - Intronic
1040542699 8:48374177-48374199 TACCCTGCTGTGCCCAGACATGG + Intergenic
1040574491 8:48639538-48639560 TATCCAGCTATCCCCAGACAGGG - Intergenic
1041390871 8:57346733-57346755 TGGCTAGGTGTCCCAAGACTTGG - Intergenic
1047402547 8:124558712-124558734 TGCCTGGGTGTCCACAGAGAAGG - Intronic
1048305234 8:133279479-133279501 TGCACAGGTGTCCCCAGTTTGGG - Intronic
1048591160 8:135821911-135821933 TGCCCTGCTCTCCCCAGATATGG - Intergenic
1048801161 8:138194888-138194910 TGCACAGATGGCCTCAGACATGG - Intronic
1049165705 8:141124411-141124433 TGCCCAGGCGGCCCCATAAAAGG + Intronic
1049536874 8:143186505-143186527 TGCCCAGGTGTCCCAGGAGGGGG + Intergenic
1052901199 9:33796219-33796241 TGGCCAGGTCTACCCAGACAGGG + Intronic
1053519315 9:38762275-38762297 TGCCCGGCTGTCTCCAGAGAGGG + Intergenic
1056221249 9:84452550-84452572 TGTCCAGGTGTCCCAAGGCCAGG + Intergenic
1059326361 9:113506291-113506313 TGCCATGGTGACCTCAGACAAGG - Intronic
1060699700 9:125740067-125740089 AGCCTAGGTGTCTGCAGACATGG - Intergenic
1061043487 9:128152516-128152538 AGCCCGGGTCTGCCCAGACAAGG + Intronic
1061544926 9:131299004-131299026 AGCCCTGGTGTCCTCTGACATGG + Intronic
1061670163 9:132184131-132184153 TGTCCAGGTGTCCCCAGGTGTGG + Intronic
1061878471 9:133556673-133556695 TGCCCAGGTGTCCCCAGACATGG - Intronic
1061913477 9:133737381-133737403 TGCAGAGGTGGCCCCGGACAAGG + Intronic
1062384776 9:136304849-136304871 TTCCCAAGTGGCCCCAGAGAAGG + Intronic
1062547290 9:137069525-137069547 GGCCCAGGTGTCCCCAGGTGCGG + Intronic
1062563542 9:137152542-137152564 TGCCCAGGTCCCCACAGAGAGGG + Intronic
1062599866 9:137314868-137314890 TGCGCACGTGTGCCCAGACCCGG - Intronic
1062738185 9:138150209-138150231 TCCCCAGGTGTCCCAAGCCCCGG - Intergenic
1203571570 Un_KI270744v1:137234-137256 TGCCCAGGATTCACAAGACAGGG - Intergenic
1186157799 X:6743747-6743769 TCCCCAGGTGTGCCATGACAGGG + Intergenic
1187334742 X:18372432-18372454 GGCCCAAGTGTCCCAAGGCATGG + Intergenic
1192081122 X:68048887-68048909 CCCCAAGCTGTCCCCAGACATGG - Intronic
1192195153 X:69023011-69023033 GGCCAGGGTGTCCCCAGGCAGGG - Intergenic
1194448909 X:94017852-94017874 TCCCAAGGCCTCCCCAGACATGG + Intergenic
1200045198 X:153397271-153397293 TGCCCAGGCCTCCCCAGCCCAGG - Intergenic