ID: 1061881280

View in Genome Browser
Species Human (GRCh38)
Location 9:133570472-133570494
Sequence CTGGTGTACCACTTGAAGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 910
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 877}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061881280_1061881288 6 Left 1061881280 9:133570472-133570494 CCCTGCTTCAAGTGGTACACCAG 0: 1
1: 0
2: 0
3: 32
4: 877
Right 1061881288 9:133570501-133570523 GTCAGAGGTGAGCTCCCAGCCGG 0: 1
1: 0
2: 1
3: 15
4: 222
1061881280_1061881293 27 Left 1061881280 9:133570472-133570494 CCCTGCTTCAAGTGGTACACCAG 0: 1
1: 0
2: 0
3: 32
4: 877
Right 1061881293 9:133570522-133570544 GGCCCCTCTGAGGTTGCCTGAGG 0: 1
1: 0
2: 0
3: 31
4: 220
1061881280_1061881283 -9 Left 1061881280 9:133570472-133570494 CCCTGCTTCAAGTGGTACACCAG 0: 1
1: 0
2: 0
3: 32
4: 877
Right 1061881283 9:133570486-133570508 GTACACCAGCCCCTGGTCAGAGG 0: 1
1: 0
2: 0
3: 16
4: 114
1061881280_1061881289 17 Left 1061881280 9:133570472-133570494 CCCTGCTTCAAGTGGTACACCAG 0: 1
1: 0
2: 0
3: 32
4: 877
Right 1061881289 9:133570512-133570534 GCTCCCAGCCGGCCCCTCTGAGG 0: 1
1: 0
2: 2
3: 29
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061881280 Original CRISPR CTGGTGTACCACTTGAAGCA GGG (reversed) Exonic
900018341 1:170076-170098 CAGGTGGACTACTTGAGGCAAGG - Intergenic
900048598 1:528671-528693 CAGGTGGACTACTTGAGGCAAGG - Intergenic
901892641 1:12280714-12280736 CAGGAGGATCACTTGAAGCAAGG - Intronic
901964242 1:12853017-12853039 CTGGCGGAACACTTGAAGCCAGG + Intronic
901970564 1:12904358-12904380 CTGGTGGATCACTTGAGGCCAGG + Intronic
902014601 1:13297411-13297433 CTGGTGGATCACTTGAGGCCAGG - Intergenic
902196471 1:14802176-14802198 CTGGTGGATCACTTGAGGCCAGG + Intronic
902261480 1:15228243-15228265 CGGGTGGATCACTTGAAGCTAGG - Intergenic
902415914 1:16239085-16239107 CTGGTGGACCACTTGAGGTCAGG + Intergenic
902596367 1:17512340-17512362 CAGGTGTATCACTTGAAGTCAGG - Intergenic
902774101 1:18663607-18663629 CGGGTGGATCACTTGAAGCCAGG - Intronic
903201773 1:21746270-21746292 CAGGTGTCCCACTTGAGGCCAGG + Intronic
903205418 1:21778683-21778705 CAGGAGGATCACTTGAAGCAAGG + Intronic
903452027 1:23460277-23460299 CTGGTGGATCACTTGAGGCCAGG + Intronic
904104174 1:28063573-28063595 CTGGTGGATCACTTGAGGCCAGG - Intronic
904390437 1:30181824-30181846 CTGGCGGATCACTTGAAGCCAGG - Intergenic
904522298 1:31105089-31105111 CCGGTGAACCACTTGAGGCCAGG - Intergenic
904857578 1:33510676-33510698 CTGGTGGATCACTTGAGGCCAGG - Intergenic
905180871 1:36165821-36165843 CTGGTGAATCACTTGAACCCAGG - Intronic
905406529 1:37736247-37736269 CAGGTGGACCACTTGAGGCCAGG + Intronic
905569035 1:38989725-38989747 CGGGTGGATCACTTGAAGCTAGG - Intergenic
905577200 1:39054813-39054835 CAGGAGTATCACTTGAACCAGGG - Intergenic
905593014 1:39181133-39181155 CGGGTGTACCGCTTGAGGCCAGG - Intronic
905765509 1:40596830-40596852 CTGGAGGATCACTTGAAGCCAGG - Intergenic
905817278 1:40961403-40961425 CTGGAGAATCACTTGAACCAGGG - Intergenic
906222621 1:44093620-44093642 CAGGTGGATCACTTGAAGCCAGG - Intergenic
906433502 1:45775427-45775449 CTGGTGGATCACTTGAGGCCAGG - Intergenic
907229391 1:52981657-52981679 CGGGTGGATCACTTGAAGCCAGG - Intronic
907531526 1:55103217-55103239 CTAGTGAACCAGGTGAAGCAAGG - Intronic
907683905 1:56591179-56591201 CAGGAGAACCACTTGAACCAGGG - Intronic
907946255 1:59139224-59139246 CAGGAGAACCACTTGAACCAGGG + Intergenic
908357628 1:63338103-63338125 CTGGAGAATCACTTGAAGCTAGG - Intergenic
908743942 1:67357127-67357149 CAGGTGGATCACTTGAAGCCAGG + Intronic
909018795 1:70408871-70408893 CTGGTGGATCACTTGAGGCAAGG + Intergenic
909143427 1:71896263-71896285 CGGGTGGATCACTTGAAGCCAGG - Intronic
909606886 1:77516840-77516862 CGGGTGCATCACTTGAAGCCAGG + Intronic
910509983 1:87992714-87992736 CAGGTGGATCACTTGAAGCCAGG + Intergenic
910683256 1:89889652-89889674 CTGGTGGATCACTTGAAGTCAGG + Intronic
910904820 1:92164388-92164410 CGGGTGGATCACTTGAAGCCAGG + Intergenic
910934885 1:92479622-92479644 CTGGTGGATCACTTGAGGCCAGG + Intronic
911601569 1:99853658-99853680 CTGGAGGACCACTTGAGGCCAGG + Intronic
911653727 1:100418955-100418977 CGGGTGGATCACTTGAAGCCAGG + Intronic
911881654 1:103246913-103246935 CTGGTTTGATACTTGAAGCATGG + Intergenic
911936647 1:103984463-103984485 CAGGTGTCACACTTGAATCATGG - Intergenic
912362733 1:109108368-109108390 CAGGTGTATCACTTGAGGCCAGG - Intronic
912408746 1:109465557-109465579 CGGGTGTATCACTTGAAGCCAGG - Intergenic
912458467 1:109815619-109815641 CTGGTGTACCACCTGGTGCCAGG + Intergenic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
914707851 1:150185933-150185955 CAGGTGGACCACTTGAAGTCAGG - Intergenic
914781226 1:150786941-150786963 CTGGTGGATCACTTGAGGCCAGG + Intergenic
915220298 1:154369154-154369176 CTGGTGGATCACTTGAAGTCAGG + Intergenic
915229888 1:154437637-154437659 CTGGTGGATCACTTGAGGCCAGG - Intronic
915436801 1:155912633-155912655 CTGGAGAACCACTTGAACCCAGG + Intergenic
915439700 1:155937760-155937782 CTGGTGGATCACTTGAGGCCAGG + Intergenic
915455658 1:156039017-156039039 CGGGTGTATCACTTGAGGCCAGG - Intronic
916041831 1:160968227-160968249 CAGGTGGATCACTTGAAGCCAGG + Intergenic
916829239 1:168474364-168474386 ATGTTGCACCCCTTGAAGCAAGG - Intergenic
917099918 1:171434690-171434712 CGGGTGGATCACTTGAGGCAGGG + Intergenic
917296335 1:173523142-173523164 CGGGTGGATCACTTGAAGTAAGG + Intronic
917424550 1:174900745-174900767 CAGGTGGATCACTTGAGGCAAGG - Intronic
917732555 1:177890921-177890943 CTGGTGGACCACTTGAGGTCAGG + Intergenic
917837109 1:178950014-178950036 CGGGTGTATCACTTGAGGCCAGG - Intergenic
917882417 1:179351134-179351156 CAGGAGAATCACTTGAAGCAGGG - Intronic
917934287 1:179849449-179849471 CTGGTGGATCACTTGAGGCCAGG - Intronic
918112180 1:181466313-181466335 CTGGTGGATCACTTGAAGCCAGG + Intronic
918711897 1:187741591-187741613 CAGGTGGATCACTTGAACCAAGG + Intergenic
919107288 1:193169315-193169337 CCGGTGTATCACTTGAGGCCAGG + Intronic
919286525 1:195568772-195568794 CAGGTGGACCACTTGAAGTCAGG + Intergenic
919458511 1:197847956-197847978 CAGGTGGATCACTTGAAGCCAGG - Intergenic
920549290 1:206845142-206845164 CTGTTGTACAACTAGAAACATGG - Intergenic
920867648 1:209766634-209766656 CAGGTGGACCACTTGAGGCCAGG + Intronic
921126838 1:212185369-212185391 CGGGTGGATCACTTGAAGCCAGG + Intergenic
922106189 1:222515941-222515963 CAGGTGGACTACTTGAGGCAAGG - Intergenic
922127362 1:222741289-222741311 CTGGTGGATCACTTGAGGCCAGG - Intronic
922502652 1:226108843-226108865 CTGGTGGATCACTTGAGGCCAGG - Intergenic
922822082 1:228491531-228491553 CAGGAGAACCACTTGAACCAAGG - Intronic
923886787 1:238166174-238166196 CTGGTGGATCACTTGAGGCCAGG + Intergenic
924135666 1:240963917-240963939 CGGGTGGATCACTTGAAGCCAGG + Intronic
924224457 1:241909490-241909512 CAGGAGAACCACTTGAACCAGGG - Intergenic
924240665 1:242036982-242037004 CAGGAGAACCACTTGAACCAGGG + Intergenic
924487108 1:244495626-244495648 CTGGAGAATCACTTGAACCAGGG + Intronic
1063041179 10:2338929-2338951 CTGGAGAATCACTTGAAGCCGGG - Intergenic
1063671910 10:8105737-8105759 CTGGTATCCCACCTGAAGCATGG + Intergenic
1064180844 10:13113251-13113273 CGGGTGGATCACTTGAAGCCAGG - Intronic
1064234458 10:13561127-13561149 CAGGTGGACCACTTGAAGTTAGG + Intergenic
1064264156 10:13811358-13811380 CAGGTGGATCACTTGAAGCCAGG - Intronic
1064341798 10:14492546-14492568 CAGGTGTATCACTTGAGGCCAGG + Intergenic
1064365476 10:14703560-14703582 CAGGTGTATCACTTGAGGCCAGG - Intronic
1064558108 10:16567755-16567777 CTGGCGGACCACTTGAAGTCAGG - Intergenic
1064624460 10:17248136-17248158 CTGGAGAAACACTTGAACCAAGG + Intergenic
1065860973 10:29872115-29872137 CGGGAGGACCACTTGAAGCCAGG + Intergenic
1065918487 10:30371234-30371256 CAGGTGAATCACTTGAAGCCAGG + Intronic
1066403229 10:35095086-35095108 CTGGTGGATCACTTGAGGTAAGG + Intergenic
1066727992 10:38411395-38411417 CAGGTGGACTACTTGAGGCAAGG + Intergenic
1068789349 10:61010028-61010050 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1068916530 10:62438413-62438435 CGGGTGTATCACTTGAGGCCAGG - Intronic
1069037046 10:63656361-63656383 CTGGTGGATCACTTGAGGCCAGG + Intergenic
1069885176 10:71619105-71619127 CAGGTGGATCACTTGAAGCCAGG + Intronic
1070102038 10:73397683-73397705 TGGGTGGATCACTTGAAGCAAGG - Intronic
1070121449 10:73581195-73581217 CTGGTGGATCACTTGAGGCCTGG + Intronic
1070315851 10:75311594-75311616 CAGGTGGACCACTTGAGGCCAGG + Intergenic
1070599336 10:77854756-77854778 CAGGTGGATCACTTGAAGCCAGG + Intronic
1073307584 10:102515406-102515428 CAGGTGAATCACTTGAACCAGGG - Intronic
1074169129 10:110915929-110915951 CAGGTGTATCACTTGAAGTCTGG - Intronic
1074552902 10:114461589-114461611 CGGGTGGATCACTTGAAGCCAGG + Intronic
1074716629 10:116225814-116225836 CAGGTGGATCACTTGAAGCCAGG - Intronic
1075109655 10:119567958-119567980 CAGGTGGATCACTTGAAGCCAGG - Intergenic
1075301288 10:121326766-121326788 CAGGTGTATCACTTGAACCTGGG + Intergenic
1075759092 10:124841668-124841690 CAGGAGAACCACTTGAACCAGGG - Intergenic
1075921066 10:126213826-126213848 TTGGTTTACCCCTTAAAGCAGGG + Intronic
1076974943 11:165272-165294 CAGGTGGACTACTTGAGGCAAGG - Intergenic
1078297880 11:10093240-10093262 CTGGTGGATCACTTGAGGCCAGG - Intronic
1079059082 11:17232089-17232111 CTGGTGGATCACTTGAGGCCAGG - Intronic
1079067390 11:17307385-17307407 CAGGAGGACCACTTGAAGCCAGG - Intronic
1079219469 11:18547296-18547318 CTGGTGGATCACTTGAGGCCAGG + Intronic
1079225551 11:18601635-18601657 CTGGGGGACCACTTGAGGCCTGG - Intergenic
1080833062 11:35914490-35914512 CTGGTGTATCACTTGAGGTCAGG - Intergenic
1080838142 11:35959692-35959714 CTGGTGGATCACTTGAGGCCAGG + Intronic
1080962501 11:37176983-37177005 CTGGTGAATCACTTGAAACCAGG - Intergenic
1080984367 11:37443865-37443887 CTGGTGGATCACTTGAAGTCAGG - Intergenic
1081199580 11:40200113-40200135 CTGGTGGATCACTTGAGGCCAGG + Intronic
1081818422 11:45967139-45967161 CTGGTGGATCACTTGAGGCCAGG + Intronic
1081859617 11:46325361-46325383 CAGGTGGACCACTTGAGGCCAGG - Intergenic
1083257323 11:61504679-61504701 TAGGTGGATCACTTGAAGCAAGG - Intergenic
1083569283 11:63748575-63748597 CTGGTGGATCACTTGAGGCCAGG - Intronic
1084081536 11:66829156-66829178 CAGGTGGATCACTTGAAGCCAGG + Intronic
1084497691 11:69514375-69514397 CAGGTGGATCACTTGAAGCCAGG + Intergenic
1084990585 11:72920510-72920532 CGGGTGGACCACTTGAGGCCAGG + Intronic
1085065172 11:73488674-73488696 CTAGTGTACCACTGGAAGGTTGG - Intronic
1085089685 11:73700371-73700393 CTGGTGGATCACTTGAGGCCTGG + Intronic
1085407670 11:76273052-76273074 CTGGTGGATCACTTGAGGCCAGG + Intergenic
1086070348 11:82792692-82792714 CAGGAGTACCACTTGAACCCGGG - Intergenic
1086381068 11:86254713-86254735 CTGGTGAATCACTTGAACCCGGG - Intronic
1086461986 11:87015215-87015237 CAGGAGTATCACTTGAACCAGGG - Intergenic
1086667024 11:89495202-89495224 CTGGTGGATCACTTGAACCCAGG - Intronic
1086752778 11:90518779-90518801 CTGGTGGACCACCTGAGGCCAGG - Intergenic
1087251563 11:95905995-95906017 CAGGTGGATCACTTGAAGCCAGG + Intronic
1087997995 11:104835613-104835635 CAGGTGGATCACTTGAAGCCAGG - Intergenic
1088035724 11:105311935-105311957 CTGGAGGACCACTTAAAGCCAGG - Intergenic
1088455777 11:110031332-110031354 CTGGTGAATCACCTGAAGGAGGG - Intergenic
1088689886 11:112316612-112316634 TTGGTGAAACACTTGTAGCAAGG - Intergenic
1089082872 11:115791856-115791878 CTGGTGTCCCACTTTAACCCTGG + Intergenic
1089427978 11:118395845-118395867 CTGGTGGATCACTTGAGGCCAGG + Intronic
1089428467 11:118400882-118400904 CGGGTGGATCACTTGAAGCTAGG + Intronic
1089975738 11:122730056-122730078 CAGGTGGATCACTTGAAGCCAGG + Intronic
1091471836 12:735418-735440 CAGGTGTATCACTTGAGGCCAGG + Intergenic
1091992296 12:4965211-4965233 CTGCTGTACCACTTCAGGCTGGG - Intergenic
1092158409 12:6300320-6300342 CAGGTGGATCACTTGAAGCCAGG - Intergenic
1092275108 12:7054864-7054886 CAGGTGGACCACTTGAGGCCAGG - Intronic
1092359625 12:7825231-7825253 CGGGTGGATCACTTGAAGCCAGG + Intronic
1092459837 12:8676624-8676646 CGGGTGGACCACTTGAGGCCAGG - Intergenic
1092613355 12:10194178-10194200 CAGGTGAACCACTTGAACCCAGG - Intergenic
1092824543 12:12386226-12386248 CAGGTGGATCACTTGAGGCAAGG - Intronic
1092854336 12:12658420-12658442 CGGGTGGATCACTTGAAGCCAGG + Intergenic
1092856343 12:12677502-12677524 CGGGTGGATCACTTGAGGCAAGG - Intronic
1093053738 12:14533914-14533936 CTGGAGGACCACTTGAACCCAGG + Intronic
1093176149 12:15915520-15915542 CTGGAGTATCACTTGAGGCTAGG - Intronic
1093642009 12:21538704-21538726 ATGAGGTGCCACTTGAAGCAGGG - Intronic
1093648128 12:21612207-21612229 CAGGTGGACCACTTGAGGCCAGG + Intergenic
1094654633 12:32408528-32408550 CAGGTGGATCACTTGAAGCTAGG - Intronic
1094778354 12:33759039-33759061 CTGCTGCACCACTGGAACCAAGG + Intergenic
1095379217 12:41569345-41569367 CTGGTGGACCACTTGAGGTCAGG - Intronic
1095628748 12:44348964-44348986 CTGGTGTAGAACTTCAAGCCTGG - Intronic
1095861328 12:46921156-46921178 CAGGTGGATCACTTGAAGCCAGG + Intergenic
1096060692 12:48697059-48697081 CTGGTGGATCACTTGAGGCTAGG - Intronic
1096132605 12:49172128-49172150 CAGGTGTATCACTTGAGGCCAGG - Intergenic
1096182629 12:49559092-49559114 CTCGTGGACCACCTGAGGCAGGG - Intronic
1096643509 12:53013931-53013953 CGGGTGGACCACTTGAGGCCAGG + Intronic
1096926050 12:55147867-55147889 CTGGTGGATCACTTGAGGCCAGG + Intergenic
1096942938 12:55368248-55368270 CTGGTGGATCACTTGAGGCCAGG + Intergenic
1096967462 12:55639667-55639689 CTGGAGGATCACTTGAACCAGGG - Intergenic
1097115411 12:56693216-56693238 CAGGAGAACCACTTGAAGCCGGG + Intergenic
1097270366 12:57770457-57770479 CAGGTGGACCACTTGAGGCCAGG - Intronic
1097436966 12:59561808-59561830 CTGGTGGATCACTTGAGGCTAGG - Intergenic
1097626263 12:62004327-62004349 CTGGTGATCCACTTGTAACAGGG - Intronic
1097857730 12:64483777-64483799 CAGGTGTATCACTTGAGGCCAGG + Intronic
1097897704 12:64842128-64842150 CAGGTGGATCACTTGAAGCCAGG + Intronic
1098264458 12:68704680-68704702 CAGGTGGATCACTTGAAGCTAGG - Intronic
1098460387 12:70726807-70726829 CTGGTGAATCACTTGAGGCCAGG - Intronic
1098954580 12:76676685-76676707 CTGGTGGATCACTTGAAGTCAGG - Intergenic
1098991235 12:77066111-77066133 CTGGTGTGACACATGAACCATGG + Intergenic
1099956832 12:89359397-89359419 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1100184818 12:92127831-92127853 CGGGTGGACCACTTGAGGCGAGG + Intronic
1100475548 12:94932111-94932133 CAGGTGAACCACTTGAAGTCAGG + Intronic
1101113859 12:101512537-101512559 CAGGTAGATCACTTGAAGCAAGG - Intergenic
1102057276 12:109906120-109906142 CTGGTGCATCACTTGATACAGGG + Intronic
1102154145 12:110710946-110710968 CAGGTGGATCACTTGAAGCCAGG + Intergenic
1102181361 12:110914745-110914767 CTGGAGGACCACTTGAACCCAGG - Intronic
1102273977 12:111565766-111565788 CAGGTGGATCACTTGAAGCCAGG + Intronic
1102380021 12:112457179-112457201 CAGGTGGACCACTTGAATCCAGG + Intronic
1102388763 12:112533153-112533175 CAGGTGGACCACTTGAAGTCAGG - Intergenic
1102411774 12:112726205-112726227 CAGGAGAACCACTTGAACCAGGG - Intronic
1102427260 12:112853599-112853621 CGGGTGGATCACTTGAGGCAAGG + Intronic
1102496971 12:113326593-113326615 CTGGTGGATCACTTGAGGCCAGG - Intronic
1102542969 12:113635579-113635601 CAGGTGGATCACTTGAAGCCAGG + Intergenic
1102653656 12:114461873-114461895 CTGGTGGATCACTTGAGGCCAGG + Intergenic
1102695709 12:114797763-114797785 CAGGTGGATCACTTGAAGCCAGG - Intergenic
1102885049 12:116515532-116515554 CTGGTGGATCACTTGAGGCCAGG + Intergenic
1102908017 12:116692139-116692161 CTGGTGGATCACTTGAGGCCAGG + Intergenic
1103066154 12:117899263-117899285 CTGGAGTATCACTTGAGGCCAGG + Intronic
1103364936 12:120375056-120375078 CAGGTGGATCACTTGAAGCTAGG - Intergenic
1103369958 12:120411645-120411667 CGGGTGTATCACTTGAGGCCAGG - Intergenic
1103751273 12:123164779-123164801 CGGGTGGACCACTTGAAGCCAGG + Intronic
1103757483 12:123220470-123220492 CAGGAGTATCACTTGAACCAGGG + Intronic
1105988332 13:25591673-25591695 CAGGTGAATCACTTGAACCAAGG - Intronic
1106292968 13:28382501-28382523 CCGGTGGAAGACTTGAAGCAGGG + Intronic
1106313903 13:28577201-28577223 CTGGTATTCCCCTTGGAGCAAGG - Intergenic
1106330818 13:28737901-28737923 CTGGAGGACCGCTTGAAGCCAGG + Intergenic
1106526767 13:30547687-30547709 CTGGTGGATCACTTGAAGTCAGG + Intronic
1106698577 13:32204973-32204995 CAGGTGGACCACTTGAGGCCAGG + Intronic
1106731278 13:32543996-32544018 CGGGTGGATCACTTGAAGCCAGG - Intergenic
1107109386 13:36679632-36679654 CGGGTGGACCACTTGAAGTCAGG - Intronic
1107385144 13:39900106-39900128 CTTGTGTTCCACCTGAAGAAGGG + Intergenic
1107744490 13:43490167-43490189 CAGGTGTATCACTTGAGGCCAGG - Intronic
1107757443 13:43639799-43639821 CTGGTGGATCACTTGAGGCCAGG + Intronic
1108203546 13:48065333-48065355 CAGGTGGACCACTTGAGGCCAGG - Intronic
1108321712 13:49296707-49296729 CAGGAGGACCACTTGAAGCCAGG + Intergenic
1108971979 13:56388059-56388081 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1109431213 13:62237773-62237795 CTGGAGTATCACTTGAAGCCAGG - Intergenic
1109984920 13:69967655-69967677 CTGGTGGATCACTTGAGGCCAGG + Intronic
1110221399 13:73078400-73078422 CTGGTGGATCACTTGAAGCCAGG - Intergenic
1111054501 13:82931180-82931202 CAGGTGAATCACTTGAACCAGGG - Intergenic
1111515032 13:89319191-89319213 CTGGTGGATCACTTGAGGCCAGG + Intergenic
1112408747 13:99143953-99143975 CTGGAGAACCACTTGAGGCCAGG + Intergenic
1112532712 13:100220496-100220518 CAGGTGGATCACTTGAAGTAAGG - Intronic
1113287405 13:108867114-108867136 CTGGTGGATCACTTGAGGCCAGG + Intronic
1113354446 13:109565270-109565292 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1113389195 13:109879634-109879656 TGGGTGGACCACTTGAAGCCAGG + Intergenic
1113603561 13:111588542-111588564 CTGGAGTACCACCTGCAGCATGG - Intronic
1114322006 14:21554862-21554884 CTGGTGGATCACTTGAAGCCGGG - Intergenic
1115104105 14:29739061-29739083 CTGGAGGATCACTTGAAGCAAGG - Intronic
1115262030 14:31464103-31464125 CGGGTGGACCACTTGAACCCAGG + Intergenic
1115552936 14:34520728-34520750 CGGGTGGATCACTTGAGGCAGGG - Intronic
1115569028 14:34649848-34649870 TAGGTGGACCACTTGAAGCCAGG + Intergenic
1115593560 14:34887192-34887214 CAGGAGAATCACTTGAAGCAGGG + Intergenic
1115682973 14:35762481-35762503 TGGGTGGACCACTTGAAGCCAGG - Intronic
1116025276 14:39507046-39507068 CTGGTGGACCACTTGAGGCCAGG - Intergenic
1116125679 14:40781790-40781812 CAGGAGAATCACTTGAAGCAAGG - Intergenic
1116468736 14:45263083-45263105 CAGGTGGATCACTTGAAGCCAGG - Intergenic
1116595914 14:46844771-46844793 CTGGTCTCTCACTTGAAACATGG - Intronic
1116905830 14:50402585-50402607 CGGGTGGACCACTTGAAGTCAGG - Intronic
1117415283 14:55490007-55490029 CAGGAGAACCACTTGAACCAAGG - Intergenic
1117415301 14:55490142-55490164 CGGGTGGATCACTTGAAGTAAGG - Intergenic
1117680144 14:58195405-58195427 CTGGAGAATCACTTGAACCAGGG + Intronic
1117874367 14:60236844-60236866 CAGGTGGATCACTTGAAGTAAGG - Intergenic
1118173936 14:63419072-63419094 CGGGTGGATCACTTGAAGCCAGG - Intronic
1118247853 14:64129078-64129100 CAGGTGGATCACTTGAAGCCAGG + Intronic
1118273626 14:64366011-64366033 CGGGTGGACCACTTGAGGCCAGG - Intergenic
1118701622 14:68439211-68439233 CTGGGACACCACTGGAAGCAAGG - Intronic
1119042291 14:71285951-71285973 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1119050633 14:71364972-71364994 CAGGTGCATCACTTGAAGCCAGG - Intronic
1119278792 14:73385727-73385749 CTGGTGGATCACTTGAGGCCAGG - Intronic
1119491247 14:75035427-75035449 CTGGTGAACCGCTTGAACCCAGG + Intronic
1119728560 14:76937003-76937025 CTGGTGGATCACTTGAAGTCAGG - Intergenic
1119814753 14:77555844-77555866 CGGGTGTATCACTTGAGGCCAGG - Intronic
1120162681 14:81162607-81162629 CTGGAGGACCACTTGAGGCCAGG + Intergenic
1120459347 14:84773990-84774012 CTGGTGGATCACTTGAAACCAGG - Intergenic
1120817602 14:88879902-88879924 CGGGTGGACCACTTGAGGCCAGG - Intronic
1121230147 14:92351627-92351649 CGGGTGGATCACTTGAAGCCAGG + Intronic
1121566068 14:94910097-94910119 CAGGTGGATCACTTGAAGCCAGG + Intergenic
1122730695 14:103795163-103795185 CGGGTGGATCACTTGAAGCCAGG - Intronic
1123433037 15:20234507-20234529 CAGGTGGATCACTTGAAGCCAGG - Intergenic
1123840956 15:24246682-24246704 CCTGTGTACCACCCGAAGCATGG + Intergenic
1123853918 15:24387194-24387216 CCTGTGTACCACCCGAAGCATGG + Intergenic
1123869880 15:24559833-24559855 CCTGTGTACCACCCGAAGCATGG + Intergenic
1123896803 15:24838125-24838147 CTGGAGAATCACTTGAACCAGGG - Intronic
1124656456 15:31513096-31513118 CTGGTGGATCACTTGAGGCCAGG - Intronic
1126050351 15:44679618-44679640 CAGGTGGATCACTTGAAGCCAGG - Intronic
1126427744 15:48547496-48547518 CTGGTGGAAAACTTAAAGCAGGG + Intronic
1127119934 15:55762824-55762846 CTGGTGGATCACTTGAGGCCAGG + Intergenic
1127211934 15:56782271-56782293 CTGGTGGATCACTTGAGGCCAGG - Intronic
1127412792 15:58726335-58726357 CGGGTGGATCACTTGAAGCGAGG + Intronic
1127430044 15:58896329-58896351 CTGGTGGATCACCTGAAGCCAGG + Intronic
1127504093 15:59581574-59581596 CTGGGGTAAGACTAGAAGCAAGG - Intergenic
1128004377 15:64225234-64225256 CAGGTGGACCACTTGAGGCCAGG - Intronic
1128149446 15:65353996-65354018 CAGGAGAATCACTTGAAGCAGGG - Intronic
1128852532 15:70974032-70974054 CTGGAGAATCACTTGAACCAGGG + Intronic
1129029317 15:72607139-72607161 CTGGTGGATCACTTGAGGTAAGG - Intergenic
1129042072 15:72696816-72696838 ATGGAGTATCACTTGAAGCCAGG - Intronic
1129046991 15:72744472-72744494 CAGGTGGATCACTTGAAGCCAGG - Intergenic
1129187308 15:73917040-73917062 CAGGTGAATCACTTGAAGCCAGG + Intergenic
1130083059 15:80751512-80751534 CTGGAGTATCACTTGAGGCCAGG + Intronic
1130293470 15:82625058-82625080 CAGGTGGATCACTTGAAGCCAGG - Intronic
1130547235 15:84865729-84865751 CAGGTGGACCACTTGAGGCCAGG + Intronic
1131162808 15:90119249-90119271 CAGGAGTATCACTTGAAGCCAGG + Intergenic
1131208030 15:90468290-90468312 CGGGTGGACCACTTGAGGCCAGG - Intronic
1131914922 15:97254571-97254593 CTGGTGGATCACTTGAGGCCAGG + Intergenic
1131950630 15:97677706-97677728 CAGGTGGACCACTTGAGGCCAGG - Intergenic
1132001407 15:98184262-98184284 CAGGTGGACCACTTGAGGCCAGG + Intergenic
1132224553 15:100130269-100130291 CAGGAGAATCACTTGAAGCAGGG + Intronic
1132329588 15:101002957-101002979 CAGGTGGATCACTTGAAGCCAGG - Intronic
1132620444 16:864848-864870 CAGGTGTATCACTTGAAGTCAGG - Intronic
1132876349 16:2140197-2140219 CAGGTGGATCACTTGAAGCCAGG - Intergenic
1132924389 16:2420969-2420991 CAGGTGGATCACTTGAAGCCAGG - Intergenic
1132948954 16:2549583-2549605 CAGGAGTACCACTTGAACCTGGG - Intronic
1132965633 16:2652544-2652566 CAGGAGTACCACTTGAACCTGGG + Intergenic
1132993542 16:2810737-2810759 CTGGCGTACAAATTGAGGCAAGG + Intergenic
1133043173 16:3071557-3071579 CAGGAGAACCACTTGAACCAGGG + Intronic
1133389317 16:5396411-5396433 CAGGTGAACCACTTGAGGCCAGG + Intergenic
1133622814 16:7542625-7542647 CGGGTGGATCACTTGAAGCCAGG + Intronic
1133684844 16:8156546-8156568 CTGGTGGATCACTTGAGGCCAGG + Intergenic
1133718432 16:8471380-8471402 CTGATGGATCACTTGAAGCCAGG + Intergenic
1133999374 16:10770643-10770665 CTGGTAGATCACTTGAGGCAAGG + Intronic
1134031298 16:10994609-10994631 CTGGAGTATCACTTGAACCCAGG + Intronic
1134206175 16:12239598-12239620 CTGGAGAATCACTTGAGGCAAGG + Intronic
1134411539 16:14006248-14006270 CAGGAGAACCACTTGAAGCCGGG + Intergenic
1134455341 16:14391281-14391303 CTGGAGAACCACTTGAACCTGGG - Intergenic
1134654960 16:15941284-15941306 CTGGGGGATCACTTGAAGCTAGG - Intergenic
1135071090 16:19352328-19352350 CAGGTGGATCACTTGAAGCCAGG + Intergenic
1135275527 16:21109028-21109050 CTGGTGAATCACTTGAATCTGGG + Intronic
1135300763 16:21325041-21325063 CGGGTGGACCACTTGAGGCCAGG - Intergenic
1135357216 16:21779447-21779469 CAGGTGGATCACTTGAAGCCAGG + Intergenic
1135455720 16:22595563-22595585 CAGGTGGATCACTTGAAGCCAGG + Intergenic
1135533829 16:23277386-23277408 CGGGTGGATCACTTGAAGCCAGG + Intergenic
1135760575 16:25134826-25134848 CAGGTGGACCACTTGAGGCCAGG - Intronic
1135987911 16:27197690-27197712 CAGGGGGACCACTTGAAGCCAGG + Intergenic
1136044905 16:27607832-27607854 CGGGTGGACCACTTGAGGCCAGG - Intronic
1136174971 16:28510371-28510393 CTGGCGGATCACTTGAAGCCAGG - Intronic
1136559440 16:31030392-31030414 AGGGTGTATCACTTGAAGCCAGG - Intergenic
1136578189 16:31136535-31136557 CTGGAGCATCACTTGAAGCCAGG + Intergenic
1137417681 16:48299355-48299377 CTGGTGGATCACTTGAGGCCAGG + Intronic
1137433902 16:48440180-48440202 CGGGTGGATCACTTGAAGCTAGG - Intronic
1137682093 16:50357751-50357773 CAGGTGTACCACTTGAGGCCGGG + Intronic
1137800409 16:51257640-51257662 CTGGAGAATCACTTGAACCAGGG + Intergenic
1138253985 16:55536171-55536193 CTGGAGTAGCACTTTGAGCAAGG - Intronic
1138524704 16:57596384-57596406 CAGGTGGATCACTTGAAGCCAGG - Intergenic
1138569682 16:57861728-57861750 CTGGTGGATCACTTGAGGCCAGG + Intronic
1138654506 16:58483011-58483033 CAGGTGGATCACTTGAAGCCAGG - Intronic
1138763975 16:59577976-59577998 CAGGAGAACCACTTGAACCAGGG + Intergenic
1139311039 16:66028350-66028372 CGGGTGGATCACTTGAGGCAAGG - Intergenic
1139479165 16:67219254-67219276 CTGGTGGATCACTTGAGGCCAGG - Intronic
1139748687 16:69095210-69095232 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1140402552 16:74683366-74683388 CTGGTGGATCACTTGAGGCCAGG + Intronic
1140446689 16:75034852-75034874 CTGGTGGATCACTTGAGGCCAGG - Intronic
1140512602 16:75518794-75518816 CTGGTGTATCACTTGAGGTCAGG + Intergenic
1140751419 16:78027881-78027903 CGGGTGGACCACTTGAGGCCAGG - Intronic
1141213671 16:82004398-82004420 CTGGTGTGCAAACTGAAGCATGG + Intronic
1141282750 16:82643975-82643997 CTGGAGGATCACTTGAAGCCAGG - Intronic
1141471592 16:84242381-84242403 CAGGTGGATCACTTGAAGCCAGG - Intergenic
1141505229 16:84472480-84472502 CGGGTGGATCACTTGAAGCCTGG + Intergenic
1141710105 16:85693803-85693825 CAGGAGAATCACTTGAAGCAGGG - Intronic
1141854466 16:86671739-86671761 CTGGTGTGCCACGTGGAGCCGGG + Intergenic
1142180371 16:88666129-88666151 CAGGCGTATCACTTGAGGCAAGG - Intergenic
1142344685 16:89546448-89546470 CAGGTGGATCACTTGAAGCCAGG + Intronic
1142445319 16:90132387-90132409 CAGGTGGACTACTTGAGGCAAGG + Intergenic
1142633591 17:1242561-1242583 CAGGAGGATCACTTGAAGCAAGG - Intergenic
1142828103 17:2527121-2527143 CGGGTGGAACACTTGAAGTAAGG - Intergenic
1143089647 17:4441840-4441862 CTGGTGGACCACTTGAGGTCAGG - Intronic
1143413141 17:6724431-6724453 CTGGTGGATCACTTGAAGTCAGG + Intergenic
1143741584 17:8958081-8958103 CTGGTGGATCACTTGAGGCCAGG + Intronic
1144442666 17:15297881-15297903 CGGGTGGACCACTTGAGGTAGGG - Intergenic
1144992628 17:19244229-19244251 CTGGTGGATCACTTGAGGCCAGG + Intronic
1145076428 17:19858740-19858762 CAGGTGGACCACTTGAAGTCAGG + Intronic
1145732548 17:27202276-27202298 CTGGAGTACCACTTGAGCCCAGG + Intergenic
1145741400 17:27277828-27277850 CTGGTGGATCACTTGAGGCCAGG + Intergenic
1145800130 17:27677265-27677287 CAGGTGCACCACTTGAGCCAGGG + Intergenic
1146008152 17:29175181-29175203 TGGGTGGACCACTTGAAGCCAGG - Intronic
1146143128 17:30387208-30387230 CTGGAGAATCACTTGAAGCCAGG - Intronic
1146378777 17:32313127-32313149 CTGGAGGACCACTTGAGGCCAGG + Intronic
1146414438 17:32618860-32618882 CAGGTGAACCACTTGAAGTCTGG - Intronic
1147289337 17:39429090-39429112 CTGGAGGATCACTTGAAGCCAGG + Intronic
1147404861 17:40203948-40203970 CAGGAGAATCACTTGAAGCAGGG + Intergenic
1147713672 17:42489170-42489192 CAGGAGAATCACTTGAAGCAGGG - Intronic
1147847395 17:43414105-43414127 CAGGTGTATCACTTGAACCTGGG + Intergenic
1147944614 17:44073819-44073841 CTGGAGGATCACTTGAAGCCAGG - Intronic
1148182632 17:45617957-45617979 CAGGTGAATCACTTGAAGCCAGG - Intergenic
1148223346 17:45880766-45880788 CTGGTGGATCACTTGAGGCCAGG + Intergenic
1148266226 17:46227738-46227760 CAGGTGAATCACTTGAAGCCAGG + Intergenic
1148285266 17:46384358-46384380 CGGGTGGATCACTTGAAGCCAGG + Intergenic
1148307430 17:46601954-46601976 CGGGTGGATCACTTGAAGCCAGG + Intronic
1148401338 17:47364404-47364426 CAGGAGAACCACTTGAACCAGGG - Intronic
1149305636 17:55344058-55344080 CTGGTGAATCACTTGAGGCCAGG + Intergenic
1149744480 17:59082176-59082198 CTGGAGAACCACTTGAAGCCGGG + Intronic
1149744714 17:59085095-59085117 CGGGTGGAACACTTGAAGCCAGG + Intronic
1149770846 17:59319742-59319764 CTGGAGAACCACTTGAACCCGGG - Intergenic
1149944002 17:60900979-60901001 CTGGTGCATCACTTGAGGCCAGG + Intronic
1150036946 17:61811857-61811879 CAGGTGAATCACTTGAACCAGGG + Intronic
1150575161 17:66424344-66424366 CTGGTGGATCACTTGAGGCCAGG + Intronic
1150743186 17:67796098-67796120 CTGGTGGATCACTTGAGGCTAGG + Intergenic
1150782883 17:68137280-68137302 CAGGTGGATCACTTGAAGTAAGG - Intergenic
1150901894 17:69288314-69288336 CTGATGTACCACTTTACACAGGG - Intronic
1151385365 17:73752050-73752072 CAGGTGGATCACTTGAAGCCAGG + Intergenic
1151473767 17:74333586-74333608 CGGGTGGACCACTTGAAGTCAGG - Intronic
1151690665 17:75682868-75682890 CAGGAGAATCACTTGAAGCAGGG + Intronic
1151695572 17:75714981-75715003 CAGGTGGATCACTTGAAGCCAGG - Intergenic
1151722138 17:75863221-75863243 TGGGTGGATCACTTGAAGCAAGG + Intergenic
1152826225 17:82466918-82466940 CAGGTGGATCACTTGAAGCCAGG - Intronic
1153047459 18:870026-870048 CTGGTGGATCACTTGAGGCCAGG + Intergenic
1154317053 18:13312512-13312534 CGGGAGTACCACTTGAGGCCAGG + Intronic
1155314381 18:24557170-24557192 CAGGTGGATCACTTGAGGCAAGG - Intergenic
1155915308 18:31551601-31551623 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1156250815 18:35351093-35351115 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1156315495 18:35965419-35965441 CAGGTGGATCACTTGAAGCCAGG - Intergenic
1156332754 18:36140069-36140091 CAGGAGAACCACTTGAAGCCAGG - Intronic
1156573044 18:38280559-38280581 CTGGTGGATCACTTGAGGCCAGG + Intergenic
1157715453 18:49882533-49882555 CAGGTGAATCACTTGAACCAGGG + Intronic
1157825196 18:50806160-50806182 CGGGTGGACCACTTGAAGTCAGG - Intronic
1158099327 18:53811698-53811720 TGGGTGGACCACTTGAAGAAAGG - Intergenic
1158549243 18:58420874-58420896 CTGATGTACCCCTTGCAGCACGG + Intergenic
1158596092 18:58817103-58817125 CTGTTGTATCACTTGAGGCCAGG + Intergenic
1159034271 18:63262142-63262164 CAGGTGGATCACTTGAAGCCAGG - Intronic
1159103922 18:63984072-63984094 CAGGTGTATCACTTGAGGCCAGG - Intronic
1159582354 18:70247595-70247617 CAGGTGGATCACTTGAAGCCAGG + Intergenic
1160964719 19:1742107-1742129 CAGGAGAATCACTTGAAGCAGGG - Intergenic
1161004980 19:1930718-1930740 CGGGTGGATCACTTGAAGCCAGG - Intergenic
1161305177 19:3563541-3563563 CGGGAGGACCACTTGAAGCCAGG - Intronic
1161427808 19:4213721-4213743 CAGGAGTATCACTTGAACCAGGG - Intronic
1161528332 19:4771184-4771206 CAGGTGGACCACTTGAGGCCAGG + Intergenic
1161741539 19:6024005-6024027 CGGGTGTACCACTTGAGGTCAGG - Intronic
1162351517 19:10152870-10152892 CAGGAGGACCACTTGAAGCCAGG + Intronic
1162366726 19:10254242-10254264 CAGGTGGATCACTTGAGGCAAGG - Intronic
1162600590 19:11665437-11665459 CTGGTGCCCCCCTTGCAGCAAGG + Intergenic
1162772280 19:12956424-12956446 CAGGTGGATCACTTGAAGTAAGG + Intronic
1162852508 19:13441728-13441750 CTGGTGGGCCGCTTGAAGCCGGG - Intronic
1162863172 19:13523824-13523846 CTGGTGGATCACTTGAGGCCAGG + Intronic
1162885365 19:13693160-13693182 CAGGAGAATCACTTGAAGCAGGG - Intergenic
1163264533 19:16211184-16211206 CTGGAGAAGCACTTGAAGCCCGG - Intronic
1163456957 19:17412492-17412514 CGGGTGGAACACTTGAAGCCAGG - Intronic
1163757894 19:19117575-19117597 CAGGTGAATCACTTGAAGCCAGG + Intergenic
1163779154 19:19237134-19237156 CTGGTGGATCACTTGAGGCCAGG - Intronic
1164287338 19:23830235-23830257 CTGGAGAACCACTTGAACCTGGG - Intergenic
1165226866 19:34361003-34361025 CAGGTGGATCACTTGAAGCCAGG - Intronic
1165353280 19:35288731-35288753 CTGGAGGATCACTTGAAGCCAGG + Intergenic
1165506107 19:36231133-36231155 CAGGTGTATCACTTGAGGCCAGG + Intronic
1165589960 19:36960208-36960230 CTGGAGAACCACTTGAACCCGGG - Intronic
1165615702 19:37198397-37198419 CTGGTGGACCACCTGAGGTAGGG - Intronic
1165640978 19:37386367-37386389 CTGGTGGATCACTTGAGGCCAGG - Intronic
1165709796 19:38002914-38002936 CAGGTGGATCACTTGAAGCCAGG + Intronic
1165928158 19:39340265-39340287 CTGGTGGATCACTTGAGGCCAGG - Intronic
1166099245 19:40561238-40561260 CAGGTGGACCACTTGAGGCCAGG - Intronic
1166974187 19:46594305-46594327 CAGGAGGATCACTTGAAGCAAGG - Intronic
1167355099 19:48998798-48998820 CTGGTGTATCACTTGAGGCCAGG + Intronic
1167809554 19:51816473-51816495 CTGGTGGATCACTTGAGGCCAGG - Intronic
1167968728 19:53171845-53171867 CTGGAGAATCACTTGAACCAGGG - Intronic
1168225095 19:54988940-54988962 CTGGTGTATCGCTTGAAGTCAGG + Intronic
1168274365 19:55268896-55268918 CAGGTGGATCACTTGAAGCCAGG - Intronic
1168386984 19:55972205-55972227 CAGGAGAATCACTTGAAGCAGGG - Intronic
1168402623 19:56094399-56094421 CTGGTGGATCACTTGAGGCCAGG - Intronic
1168417448 19:56177581-56177603 CGGGTGGATCACTTGAAGCCAGG - Intronic
1168579825 19:57545783-57545805 CAGGTGGACCACTTGAAGCCAGG + Intronic
1168600448 19:57713859-57713881 CTGGTGGATCACTTGAAGTCAGG - Intronic
1202655628 1_KI270708v1_random:17929-17951 CAGGTGTATCACTTGAGGCCAGG - Intergenic
925759066 2:7166690-7166712 CGGGTGCACCACTTGAGGCCAGG - Intergenic
925915024 2:8598579-8598601 CTGGTGGATCACTTGAGGCCAGG + Intergenic
925953790 2:8940518-8940540 CAGGTGGATCACTTGAAGCCAGG - Intronic
926481393 2:13400368-13400390 CTGGTGGACCACTTGAGGTTCGG - Intergenic
926648301 2:15314124-15314146 CAGGTGGATCACTTGAAGCTAGG + Intronic
926651345 2:15349724-15349746 CTGGTGGATCACTTGAGGCCAGG + Intronic
926669843 2:15566406-15566428 CTGGTATAGTGCTTGAAGCAGGG - Intergenic
927049899 2:19317050-19317072 CGGGTGAATCACTTGAAGCCAGG - Intergenic
927540870 2:23910269-23910291 CTGGAGAACCACTTGAACCCGGG - Intronic
927560797 2:24071510-24071532 CTGGAGAACCACTTGAACCTGGG + Intronic
927907578 2:26871666-26871688 CGGGTGGATCACTTGAAGCCAGG - Intronic
928653362 2:33424794-33424816 CTGGAGAACCACTTGAACCTGGG - Intergenic
928707289 2:33964131-33964153 CAGGAGAACCACTTGAACCAGGG - Intergenic
928993393 2:37259935-37259957 CAGGTGGATCACTTGAGGCAAGG + Intronic
928995355 2:37283757-37283779 CAGGTGGATCACTTGAAGCCAGG + Intronic
929201565 2:39242868-39242890 CGGGTGGAGCACTTGAAGCCAGG + Intergenic
929287515 2:40152641-40152663 CTGGTGGATCACTTGAGGCCAGG - Intronic
929661394 2:43788859-43788881 CTGGAGGATCACTTGAAGCCAGG - Intronic
929966370 2:46540326-46540348 CTGGAGAATCACTTGAACCAGGG + Intronic
929981929 2:46689381-46689403 CTGGTGGATCACTTGAGGCCAGG + Intergenic
929983550 2:46702840-46702862 ATGGTGTATCACTTAAAGAATGG + Intronic
930163477 2:48181058-48181080 CGGGTGTATCACTTGAGGCCAGG - Intergenic
930308048 2:49701884-49701906 CTGGTGGATCACTTGAAGTCAGG + Intergenic
930771294 2:55132982-55133004 CAGGTGGATCACTTGAAGCCAGG + Intergenic
930783543 2:55247981-55248003 CTGGAGGACCACTTGAGCCAGGG - Intronic
930790688 2:55324871-55324893 CAGGTGTATCACTTGAGGCCAGG - Intronic
931348007 2:61464224-61464246 CAGGAGAATCACTTGAAGCAAGG + Intronic
931525881 2:63152497-63152519 CAGGTGGATCACTTGAAGCCAGG - Intronic
932587774 2:73042854-73042876 CAGGTGGATCACTTGAAGCCAGG + Intronic
932599758 2:73115314-73115336 CTGGTGGATCACTTGAAGCCAGG + Intronic
932612808 2:73212369-73212391 CAGGAGAACCACTTGAAGCCTGG - Exonic
932665555 2:73695620-73695642 CTGGTGGATCACTTGAGGCAAGG - Intergenic
933408855 2:81898874-81898896 CAGGTGGATCACTTGAAGCCAGG + Intergenic
933493022 2:83012448-83012470 CGGGTGGATCACTTGAAGCCAGG + Intergenic
933525742 2:83436244-83436266 CAGGAGTACCACTTGAAGTCAGG + Intergenic
933824957 2:86151007-86151029 CAGGAGAACCACTTGAACCAGGG - Intronic
933907192 2:86906477-86906499 CTGGTGGACCACTTGAGCCCAGG + Intergenic
933908438 2:86916139-86916161 CTGGTGGACCACTTGAGCCCAGG + Intronic
934024285 2:87987241-87987263 CTGGTGGACCACTTGAGCCCAGG - Intergenic
934077468 2:88440348-88440370 CAGGTGGACCATTTGAAGCTGGG + Intergenic
934145317 2:89087847-89087869 CAGGAGAACCACTTGAACCAGGG - Intergenic
934223939 2:90112704-90112726 CAGGAGAACCACTTGAACCACGG + Intergenic
934868058 2:97831892-97831914 CTGGTGGATCACTTGAAGTCAGG - Intronic
935030547 2:99317703-99317725 CGGGAGGACCACTTGAAGCCAGG - Intronic
935207821 2:100911857-100911879 CTGGTGGATCACTTGAGGCCAGG - Intronic
935354218 2:102183594-102183616 CGGGTGGATCACTTGAAGCCAGG + Intergenic
936364925 2:111844936-111844958 CTGGTGGACCACTTGAGTCCAGG - Intronic
936418087 2:112337847-112337869 CTGGTGGATCACTTGAGGCCAGG - Exonic
936608310 2:113978870-113978892 CAGGTGAATCACTTGAAGCCGGG + Intergenic
937215584 2:120310995-120311017 CGGGTGGACCACTTGAGGCCAGG - Intergenic
939108807 2:137982074-137982096 CTGGTGGATCACTTGAGGCCAGG - Intronic
939576282 2:143899387-143899409 CTAGTGTACTACTTAGAGCATGG - Intergenic
940356414 2:152747796-152747818 CGGGTGGATCACTTGAAGCCAGG - Intronic
940833650 2:158496206-158496228 CAGGTGGATCACTTGAAGCCAGG - Intronic
941671298 2:168296140-168296162 CAGGTGTATCACTTGAGGCCAGG - Intergenic
941700247 2:168596644-168596666 CAGGAGAACCACTTGAACCAGGG - Intronic
942050682 2:172137725-172137747 CAGGTGGATCACTTGAAGCCAGG - Intergenic
942086734 2:172450725-172450747 CAGGTGGATCACTTGAAGCCAGG + Intronic
942190973 2:173469996-173470018 CAGGTGGATCACTTGAAGCCAGG + Intergenic
942244528 2:173994886-173994908 CTGATGGACCACTTGATGGAAGG + Intergenic
943225620 2:185170227-185170249 CTGGTAGATCACTTGAGGCAAGG - Intergenic
943729283 2:191284859-191284881 CTGGTGGATCACTTGAGGCCAGG - Intronic
944074216 2:195709457-195709479 CAGGTGGATCACTTGAAGCCAGG - Intronic
944256281 2:197626336-197626358 CTGGAGGATCACTTGAAGCCAGG + Intronic
944871914 2:203920683-203920705 CTGGTGAATCACTTGAAGTCAGG + Intergenic
945222283 2:207497185-207497207 CTGGTGGATCACTTGAGGCCAGG - Intergenic
945889008 2:215408795-215408817 CTGGTGGATCACTTGAGGCCAGG - Intronic
945965297 2:216180396-216180418 CGGGTGGATCACTTGAAGCCAGG + Intronic
946494109 2:220178253-220178275 CTGGTGTATCACTTGAGGTCAGG - Intergenic
946734348 2:222739696-222739718 CAGGTGGATCACTTGAAGCCAGG + Intergenic
946850226 2:223898631-223898653 TAGGTGTACCACTTGAGGCCAGG - Intronic
947011261 2:225569517-225569539 CTTGTGTTCCTGTTGAAGCATGG - Intronic
947218303 2:227769214-227769236 CAGGTGGATCACTTGAAGCCAGG - Intergenic
947809353 2:232992328-232992350 CTGATGTATCACTTGAAGTCAGG + Intronic
947853639 2:233308230-233308252 CTGGAGGATCACTTGAAGCCAGG + Intronic
948314818 2:237019644-237019666 CGGGTGGATCACTTGAAGCCAGG - Intergenic
948472864 2:238196452-238196474 CGGGTGGACCACTTGAGGCCAGG - Intronic
948960125 2:241328337-241328359 CAGGAGTATCACTTGAACCAGGG + Intronic
948968720 2:241406689-241406711 CTGGTGGATCACTTGAACCCAGG - Intronic
1169103061 20:2968978-2969000 CAGGTGGATCACTTGAAGCCAGG + Intronic
1169119517 20:3086585-3086607 CGGGTGGATCACTTGAAGCCAGG - Intergenic
1169145080 20:3247241-3247263 CTGGTGGATCACTTGAAGTCAGG + Intergenic
1169454311 20:5738674-5738696 CAGGTGGATCACTTGAAGCCAGG - Intergenic
1169459720 20:5783922-5783944 CTGGTGGATCACTTGAAGCCAGG + Intronic
1169668908 20:8072629-8072651 CGGGTGTATCACTTGAAGTCAGG - Intergenic
1169737850 20:8856386-8856408 CTGGTGAATCACTTGAGGCCAGG + Intronic
1169898935 20:10533845-10533867 CAGGAGGACCACTTGAAGCCAGG - Intronic
1170261721 20:14416049-14416071 CAGGAGAATCACTTGAAGCAGGG - Intronic
1170843008 20:19939273-19939295 CAGGTGGACCACTTGAGGCCAGG - Intronic
1171005500 20:21461549-21461571 CAGGTGGATCACTTGAAGCCGGG + Intergenic
1171114874 20:22516620-22516642 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1172406716 20:34695258-34695280 CTGGAGTACCACTTGAGCCCAGG + Intergenic
1172501113 20:35428247-35428269 CAGGTGGATCACTTGAAGCCAGG - Intergenic
1172517458 20:35544893-35544915 CAGGTGAATCACTTGAAGCCGGG - Intronic
1172663760 20:36585268-36585290 CGGGTGTATCACTTGAGGCCAGG + Intronic
1172688030 20:36772106-36772128 CTGGTGGATCACTTGAGGCCAGG - Intronic
1173109988 20:40177665-40177687 CTGGAGAATCACTTGAAGCCAGG + Intergenic
1174366449 20:50059414-50059436 CTGGTGGATCACTTGAGGCCAGG + Intergenic
1174571410 20:51504361-51504383 CTGGTGGATCACTTGAGGCCGGG - Intronic
1174768021 20:53272102-53272124 CTGGAGAATCACTTGAACCAGGG - Intronic
1175255183 20:57640141-57640163 CAGGTGGATCACTTGAAGCCAGG + Intergenic
1176416197 21:6476205-6476227 CCGGTGGATCACTTGAAGCCAGG + Intergenic
1177373640 21:20239479-20239501 CAGGTGAACCACTTGAACCTAGG + Intergenic
1177689387 21:24484670-24484692 CGGGAGGATCACTTGAAGCATGG + Intergenic
1177818240 21:26001724-26001746 CAGGTGTATCACTTGAGGCCAGG - Intronic
1177909301 21:27011111-27011133 CTAGTGTGCCTCTTGAAGAATGG + Intergenic
1178888484 21:36500657-36500679 CGGGTGGATCACTTGAGGCAAGG - Intronic
1178891362 21:36523517-36523539 TGGGTGGACCACTTGAAGCCAGG + Intronic
1179447410 21:41441784-41441806 CTCGTGTTCCACCTGAAGAAGGG + Exonic
1179691697 21:43084539-43084561 CCGGTGGATCACTTGAAGCCAGG + Intergenic
1180627287 22:17202492-17202514 CTGGTGGATCACTTGAGGCCAGG - Intronic
1180710928 22:17839052-17839074 CAGGAGAACCACTTGAACCAGGG - Intronic
1181385767 22:22544583-22544605 CTGGAGGACCACTTGAGGCTAGG - Intergenic
1182210771 22:28675522-28675544 CTGGTGGACCACTTGAGCCCAGG + Intronic
1182565230 22:31193564-31193586 CAGGTGGATCACTTGAGGCAAGG + Intronic
1182970827 22:34574800-34574822 CTGGAGGATCACTTGAAGCCAGG - Intergenic
1183409449 22:37646481-37646503 CAGGTGGATCACTTGAAGCCAGG - Intronic
1183462397 22:37960029-37960051 CAGGTGGATCACTTGAAGCTAGG - Intronic
1183514235 22:38254370-38254392 CAGGTGGATCACTTGAAGCCAGG + Intronic
1183822403 22:40357121-40357143 CAGGTGGATCACTTGAAGCCAGG - Intronic
1183845824 22:40539225-40539247 CTGGTGGATCACTTGAGGCCAGG - Intronic
1183849631 22:40573841-40573863 CAGGTGGATCACTTGAAGCCAGG + Intronic
1183889253 22:40912639-40912661 CAGGTGGATCACTTGAAGCCAGG + Intronic
1183909987 22:41071558-41071580 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1184390542 22:44200919-44200941 TGGGTGCTCCACTTGAAGCAGGG - Intronic
1184433607 22:44456462-44456484 CAGGAGTATCACTTGAACCAGGG + Intergenic
1184558325 22:45246060-45246082 CAGGTGTATCACTTGAGGCTAGG - Intergenic
1184577203 22:45379962-45379984 CTGGTGGATCACTTGAGGCCAGG - Intronic
949240666 3:1867761-1867783 CGGGTGGACCACTTGAGGCCAGG + Intergenic
949953105 3:9245694-9245716 CGGGTGGATCACTTGAAGCTAGG + Intronic
949988545 3:9559011-9559033 CTGGTGGATCACTTGAGGCCAGG - Intergenic
951203970 3:19906091-19906113 CTGGTGGATCACTTGAGGCCAGG + Intronic
951216564 3:20030663-20030685 CTGGAGAACCACTTGAACCCCGG + Intergenic
951634436 3:24757324-24757346 CTGGGGTACCACTTGAGGTGAGG + Intergenic
952423815 3:33154293-33154315 CAGGTGGATCACTTGAAGCCAGG + Intronic
952533009 3:34281366-34281388 CAGGTGGACCACCTGAAGTATGG - Intergenic
953623607 3:44552922-44552944 CGGGTGGATCACTTGAAGCCAGG - Intergenic
954007671 3:47604926-47604948 CAGGTGGACCACTTGAGGCCAGG - Intronic
954054606 3:48011299-48011321 CGGGTGGATCACTTGAAGCCAGG + Intronic
954067518 3:48118623-48118645 CGGGTGGATCACTTGAAGCCAGG + Intergenic
954319047 3:49818569-49818591 CAGGAGAACCACTTGAACCAGGG - Intergenic
955096604 3:55804902-55804924 CTGGTCTTCCACTTGAAGTGTGG + Intronic
955507123 3:59643543-59643565 CAGGTGGATCACTTGAAGCCAGG + Intergenic
955654680 3:61232154-61232176 CTGGTGGATCACTTGAGGCCAGG + Intronic
956082300 3:65570327-65570349 CTGGTGGATCACTTGAAGTCAGG - Intronic
956154912 3:66285550-66285572 CTGGAGAACCACTTGAACCCGGG - Intronic
956323794 3:68028070-68028092 CGGGTGGACCACTTGAGGCCAGG + Intronic
956669135 3:71670301-71670323 CTGTTGTACCACTTGAGATAAGG + Intergenic
956714953 3:72070888-72070910 CGGGTGGATCACTTGAAGCCAGG - Intergenic
957506207 3:81124773-81124795 CAGGAGTACCACTTGAACCCAGG + Intergenic
958191019 3:90185178-90185200 CCAGGGTACCACTTCAAGCAGGG - Intergenic
958517642 3:95139285-95139307 CAGGAGAATCACTTGAAGCAGGG - Intergenic
958945550 3:100358003-100358025 CTGGTGGATCACTTGAGGCCAGG - Intergenic
959502558 3:107123595-107123617 CTGGTGGATCACTTGAAGCCAGG + Intergenic
959504009 3:107138078-107138100 CAGGAGAACCACTTGAACCAGGG + Intergenic
959694353 3:109233837-109233859 CAGGTGGATCACTTGAAGCCAGG - Intergenic
960033942 3:113084177-113084199 TGGGAGGACCACTTGAAGCAAGG + Intergenic
960099886 3:113730070-113730092 CGGGTGGATCACTTGAAGCCAGG + Intronic
960675498 3:120190646-120190668 CTGGTGAATCACTTGAGGCCAGG + Intronic
960895402 3:122499523-122499545 CGGGAGTATCACTTGAAGCCAGG + Intronic
961735158 3:128996855-128996877 CTGGTGTACCACTGGGGGCGGGG - Intronic
962294016 3:134164061-134164083 CTGGTGGATCACTTGAAACCAGG - Intronic
962377266 3:134868722-134868744 TTGGTGCACAACTTGAAGCCAGG - Intronic
963128553 3:141837016-141837038 CGGGTGGACCACTTGAGGCCAGG - Intergenic
963230411 3:142904069-142904091 CTGGTGGATCACTTGAGGCTGGG + Intergenic
964363044 3:155918220-155918242 CAGGTGGATCACTTGAAGCCAGG + Intronic
964487623 3:157202179-157202201 CAGGTGGATCACTTGAAGCCAGG + Intergenic
964764536 3:160166895-160166917 CAGGTGGATCACTTGAAGCCAGG + Intergenic
964789737 3:160442352-160442374 CAGGTGGATCACTTGAGGCAAGG + Intronic
965536051 3:169824738-169824760 CGGGTGGATCACTTGAAGCCAGG - Intronic
966163162 3:176989103-176989125 CAGGTGGATCACTTGAAGCCAGG + Intergenic
966385960 3:179398285-179398307 CTGGTGGATCACTTGAGGCCAGG + Intergenic
966752745 3:183338217-183338239 CGGGTGTATCACCTGAAGCCAGG + Intronic
967027949 3:185580943-185580965 CGGGTGGACCACTTGAGGCCAGG + Intergenic
967123339 3:186403380-186403402 CAGGAGAACCACTTGAATCAAGG - Intergenic
968246206 3:197151813-197151835 CTGGTGGATCACTTGAAACCAGG + Intronic
968365935 3:198184517-198184539 CAGGTGGACTACTTGAGGCAAGG + Intergenic
969412710 4:7040027-7040049 CAGGTGTATCACTTGAGGCCAGG + Intergenic
969563059 4:7961542-7961564 CAGGAGGATCACTTGAAGCAAGG + Intergenic
969639782 4:8389875-8389897 CGGGTGGATCACTTGAAGCCAGG + Intronic
969833026 4:9813866-9813888 CAGGTGGATCACTTGAAGCCAGG + Intronic
970973513 4:22014523-22014545 CTGGTGAATCACTTGAGGCCAGG + Intergenic
971095377 4:23395740-23395762 CAGGTGAATCACTTGAACCAGGG - Intergenic
971271340 4:25149291-25149313 CTTGTGGATCACTTGAAGCCAGG - Intronic
971448414 4:26777674-26777696 CTGGTGGATCACTTGACGCCAGG - Intergenic
972517818 4:39825678-39825700 CTGGAGGACCACTTGAACCCAGG - Intronic
973242389 4:47970557-47970579 CAGGAGAACCACTTGAACCAGGG + Intronic
973651869 4:53004770-53004792 ATGGTGCACCACTGGAAGTAAGG + Intronic
974463203 4:62217131-62217153 CAGGTGTATCACTTGAAGTCAGG - Intergenic
974783287 4:66583144-66583166 CAGGAGGACCACTTGAAGCCAGG - Intergenic
974792856 4:66713067-66713089 GTGGAGGACCACTTGAAGCTGGG - Intergenic
975564034 4:75734954-75734976 CGGGTGGATCACTTGAGGCAAGG - Intronic
975862040 4:78687707-78687729 CAGGAGAATCACTTGAAGCAGGG + Intergenic
976290842 4:83415872-83415894 CAGGTGGATCACTTGAAGCCAGG - Intronic
978125639 4:105131977-105131999 CAGGTGGATCACTTGAGGCAAGG - Intergenic
978264806 4:106810772-106810794 CTGGAGTATCACTTGAGGCCAGG - Intergenic
978507857 4:109479660-109479682 CAGGAGTATCACTTGAAGCCAGG - Intronic
978531200 4:109715700-109715722 CTGGTGGACCACTTGAGCCCAGG - Intronic
979264714 4:118688125-118688147 CAGGTGTACCACTTGAGCCCAGG - Intronic
979333990 4:119446344-119446366 CAGGTGGACTACTTGAGGCAAGG - Intergenic
980230684 4:130042606-130042628 CTGGCGAATCACTTGAAGCCAGG - Intergenic
980475863 4:133315493-133315515 CTGGTGTCCAACTTGTGGCATGG + Intergenic
980551172 4:134337149-134337171 CAGGAGAACCACTTGAACCAGGG - Intergenic
980947620 4:139338538-139338560 CAGGAGAATCACTTGAAGCAGGG - Intronic
981991048 4:150921663-150921685 CTGGTGAATCACTTGAATCTGGG - Intronic
982007751 4:151079656-151079678 CTGGTGGATCACTTGAAGCCAGG - Intergenic
982170088 4:152653615-152653637 CGGGTGGATCACTTGAGGCATGG - Intronic
982229555 4:153196035-153196057 CAGGTGTATCACTTGAGGCCAGG - Intronic
982364281 4:154558383-154558405 CTGGTGGATCACTTGATGCCAGG + Intergenic
982389170 4:154846122-154846144 CAGGTGTATCACTTGAGGCCGGG - Intergenic
982904937 4:161056291-161056313 CAGGAGAACCACTTGAACCAGGG - Intergenic
983102545 4:163643441-163643463 CAGGTGGATCACTTGAAGCCAGG - Intronic
983527162 4:168770965-168770987 CTGGTGAATCACTTGAAGCCAGG + Intronic
983562261 4:169113201-169113223 CTGGAGAATCACTTGAACCAGGG - Intronic
984562381 4:181286010-181286032 CTGGTGGATCACTTGAAGCCAGG - Intergenic
984909653 4:184661477-184661499 CAGGTGGATCACTTGAAGCCAGG + Intronic
986057397 5:4152256-4152278 CTGGTGTCTCACCTGAATCAAGG - Intergenic
986202675 5:5592261-5592283 CAGGTGGATCACTTGAAGCCAGG - Intergenic
986689492 5:10302415-10302437 CTGGTGGATCACTTGAGGCAAGG + Intronic
986832859 5:11600476-11600498 CAGGTGGACCACTTGAAGTCAGG + Intronic
987190365 5:15471008-15471030 CGGGTGGACCACTTGAGGCCAGG + Intergenic
987368450 5:17171230-17171252 CTGGTAAACCACTTGAGGCCAGG - Intronic
988498661 5:31765942-31765964 CAGGTGGATCACTTGAACCAAGG + Intronic
988966214 5:36420763-36420785 CTGTTGGACCACTTGGAGTATGG + Intergenic
989333519 5:40287918-40287940 ATGGTGAACACCTTGAAGCAGGG - Intergenic
989481906 5:41940487-41940509 CGGGTGGATCACTTGAAGCCAGG - Intronic
991909274 5:71545556-71545578 CAGGTGGATCACTTGAAGCCAGG - Intronic
992117757 5:73557982-73558004 CTGGGGAATCACTTGAATCAGGG + Intronic
992128776 5:73669912-73669934 CGGGTGGACCACTTGAAGTCAGG - Intronic
992151610 5:73909829-73909851 CTGCTGGGCCACTGGAAGCACGG + Exonic
992308852 5:75473311-75473333 CTGGAGGATCACTTGAAGCCAGG - Intronic
992359056 5:76017504-76017526 CAGGTGGACCACTTGAAGTCAGG - Intergenic
992464681 5:76992050-76992072 CTGGTGGATCACTTGAGGCCAGG - Intergenic
992746198 5:79823304-79823326 CAGGAGGACCACTTGAAGCCAGG - Intergenic
992785951 5:80170786-80170808 CAGGTGAATCACTTGAAGCTAGG + Intronic
992792673 5:80227531-80227553 CGGGTGGATCACTTGAAGCCAGG + Intronic
992799598 5:80284103-80284125 CTGGTGGATCACTTGAGGCCAGG - Intergenic
995516532 5:112959912-112959934 CTGGAGAATCACTTGAACCAGGG - Intergenic
995728911 5:115215223-115215245 CTGGTGAATCACTTGAAGTCAGG - Intronic
996534182 5:124559217-124559239 CAGGAGTATCACTTGAACCAGGG + Intergenic
996885019 5:128344001-128344023 CAGGAGGACCACTTGAAGCCAGG + Intronic
996986246 5:129568590-129568612 CTGGTGGATCACTTGAGGCCAGG + Intronic
997142870 5:131401328-131401350 CTGGTGTATCACTTGAGGCCAGG + Intergenic
997306841 5:132843807-132843829 CTGGCGCATCACTTGAAGCCAGG - Intergenic
997307170 5:132846542-132846564 CTGGCGCATCACTTGAAGCCAGG + Intergenic
997417010 5:133736759-133736781 CTGGTGTCCAACCTGCAGCATGG + Intergenic
997636101 5:135408228-135408250 CAGGTGTATCACTTGAGGCCAGG - Intergenic
998299424 5:141003538-141003560 CAGGTGGATCACTTGAAGCCAGG - Intronic
998323984 5:141262326-141262348 CAGGTGGATCACTTGAAGCCAGG + Intergenic
998651533 5:144126328-144126350 CTGGTGGATCACTTGAAGTCAGG + Intergenic
998847994 5:146329478-146329500 CAGGTGGATCACTTGAAGCCAGG - Intronic
999217663 5:149948861-149948883 CTGGAGGATCACTTGAAGCCAGG + Intergenic
999817199 5:155189108-155189130 CTTGTGTTCCACTGGAAACAGGG - Intergenic
999974811 5:156901064-156901086 CGGGTGAATCACTTGAAGCTAGG + Intergenic
1000282688 5:159795668-159795690 CAGGTGTATCACTTGAGGCCAGG - Intergenic
1000760268 5:165215193-165215215 CTGGAGAATCACTTGAACCAGGG - Intergenic
1002366584 5:178717251-178717273 CTGGGGCACCAGTGGAAGCAGGG + Intronic
1002725161 5:181289741-181289763 CAGGTGGACTACTTGAGGCAAGG + Intergenic
1003070763 6:2943778-2943800 CGGGTGGATCACTTGAGGCAAGG + Intergenic
1003077065 6:2991622-2991644 CTGGTGGATCACTTGAGGCCAGG + Intronic
1003280371 6:4685932-4685954 CTGGTGGATCACTTGAGGTAAGG - Intergenic
1003663046 6:8082504-8082526 CTGGTGGATCACTTGAGGCCAGG - Intronic
1003771272 6:9304258-9304280 CAGGTGGACCACTTGAAGTTAGG - Intergenic
1004079708 6:12380241-12380263 CAGGTGGACCACTTGAAGTCAGG + Intergenic
1004366802 6:15019757-15019779 CAGGTGGATCACTTGAAGCCAGG - Intergenic
1004459256 6:15820461-15820483 AGGGTGGATCACTTGAAGCAAGG - Intergenic
1004632590 6:17436358-17436380 CGGGTGGACCACTTGAAGTCAGG - Intronic
1004658829 6:17691535-17691557 CTGGTGGATCACTTGAGGCCAGG + Intronic
1004729063 6:18340157-18340179 CTGGTGGATCACTTGATGCCAGG + Intergenic
1005377725 6:25201349-25201371 CAGGTGGATCACTTGAAGCCAGG + Intergenic
1005408162 6:25514317-25514339 CTGGTGGATCACTTGAAGTCAGG + Intronic
1005610329 6:27517807-27517829 CAGGTGGATCACTTGAGGCAAGG - Intergenic
1005974707 6:30789324-30789346 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1006387805 6:33741412-33741434 CGGGTGAATCACTTGAAGCCAGG + Intronic
1007452954 6:41954021-41954043 CTGGTGGATCACTTGAGGCCAGG + Intronic
1007559366 6:42793514-42793536 CTGGTGGATCACTTGAAGTTAGG - Intronic
1007672602 6:43568382-43568404 CTGGAGGATCACTTGAAGCCAGG + Intronic
1007958841 6:45940802-45940824 CAGGTATAACACTTGAAGAACGG - Intronic
1008942117 6:57058020-57058042 CGGGTGGATCACTTGAACCAGGG - Intergenic
1009429057 6:63546476-63546498 CAGGTGGATCACTTGAGGCAAGG + Intronic
1010952294 6:82050938-82050960 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1010963047 6:82168858-82168880 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1011678073 6:89755314-89755336 CTGGCGTATCACTTGAGGCCAGG + Intronic
1011686130 6:89825150-89825172 CTGGCGGATCACTTGAGGCAAGG - Intergenic
1011725941 6:90210930-90210952 CGGGTGGACCACTTGAAGTCAGG + Intronic
1012073514 6:94654397-94654419 CTGGTGGATCACTTGAAGCCAGG + Intergenic
1014558882 6:122866302-122866324 CAGGTGGATCACTTGAAGCCGGG - Intergenic
1014685943 6:124500419-124500441 CTGGTGGATCACTTGAATCCAGG + Intronic
1014975210 6:127872342-127872364 CAGGTGGATCACTTGAAGCCAGG + Intronic
1015302465 6:131669443-131669465 CAGGTGGATCACTTGAGGCAAGG + Intronic
1015427155 6:133084386-133084408 CTGGAGTAACACATGAAGGATGG - Intergenic
1015473776 6:133636481-133636503 CTGGAGAATCACTTGAACCAGGG - Intergenic
1016334468 6:142989560-142989582 CAGGTGGACCACTTGAGGCCAGG - Intergenic
1016915960 6:149244654-149244676 CTGGTGGAACACTTGAGGCCAGG + Intronic
1017018447 6:150120227-150120249 CAGGTGGATCACTTGAAGCCAGG - Intergenic
1017079266 6:150651764-150651786 CAGGAGAATCACTTGAAGCAGGG + Intronic
1017523495 6:155222371-155222393 CTGGTGGATCACTTGAGGCCAGG + Intronic
1017631010 6:156396745-156396767 CTGTTCTACCAATTGAAGCTTGG + Intergenic
1017772868 6:157656561-157656583 CTGGTGGATCACTTGAGGCCAGG - Intronic
1018233884 6:161704081-161704103 CTGGTGGATCACTTGAGGCCAGG - Intronic
1018250818 6:161868349-161868371 CTGGTGGATCACTCGAAGCTAGG + Intronic
1018311453 6:162513824-162513846 CAGGTGGACCACTTGAAGTCAGG + Intronic
1018392390 6:163350362-163350384 CAGGTGGATCACTTGAAGCCAGG + Intergenic
1018564786 6:165139726-165139748 CTGGTGGATCACTTGAGGCCAGG + Intergenic
1019532927 7:1512662-1512684 CTGGTGAATCACTTGAGGCCAGG - Intergenic
1020018356 7:4845323-4845345 CAGGAGTACCACTTGAACCCAGG + Intronic
1020272162 7:6603452-6603474 CTGGAGAACCACTTGAACCTAGG + Intronic
1020421296 7:8008520-8008542 CTAGTGGATCACTTGAGGCAAGG - Intronic
1020834683 7:13134674-13134696 CAGGAGTACCACTTGAACCCGGG - Intergenic
1020926652 7:14335969-14335991 CAGGAGGATCACTTGAAGCAGGG - Intronic
1021447555 7:20749463-20749485 CGGGTGGATCACTTGAAGCCGGG - Intronic
1021728773 7:23575880-23575902 CAGGTGGATCACTTGAAGCCAGG - Intergenic
1024070067 7:45777353-45777375 CAGGTGGACTACTTGAGGCAAGG + Intergenic
1024275716 7:47675304-47675326 CAGGAGAACCACTTGAACCAGGG - Intergenic
1024571746 7:50728896-50728918 CGGGTGGACCACTTGAGGCCAGG - Intronic
1025856138 7:65280882-65280904 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1025930140 7:65986867-65986889 CCGGAGAACCACTTGAACCAAGG + Intergenic
1026049796 7:66935769-66935791 CAGGTGGATCACTTGAAGCCAGG - Intronic
1026161332 7:67871393-67871415 CAGGTGAACCACTTGAGGCCAGG - Intergenic
1026343302 7:69452597-69452619 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1026346184 7:69476105-69476127 CAGGTGAATCACTTGAAGCCAGG + Intergenic
1026509004 7:71012170-71012192 CAGGTGTATCACTTGAGGCCAGG - Intergenic
1026790291 7:73327247-73327269 CTGGAGGATCACTTGAAGCCAGG + Intronic
1026923032 7:74170346-74170368 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1027048314 7:75005900-75005922 CGGGTGGATCACTTGAAGTAAGG + Intronic
1027394394 7:77739483-77739505 CGGGTGGGCCACTTGAAGCTAGG + Intronic
1027774827 7:82451068-82451090 CAGGTGGATCACTTGAAGCCTGG - Intergenic
1028669819 7:93388416-93388438 CTGGTGGATCACTTGAGGCCAGG + Intergenic
1029528581 7:101110466-101110488 CTGGAGTATCACTTGAGGCCAGG - Intergenic
1029732229 7:102446174-102446196 CTGGTGGATCACTTGAGGCCAGG - Intronic
1030000130 7:105050952-105050974 CAGGTGGACCACTTGAGGCCAGG - Intronic
1030051335 7:105540487-105540509 CTGGTGGATCACTTGAGGTAAGG - Intronic
1030595732 7:111536532-111536554 CTGGTGGACCACTTGAATTCAGG - Intronic
1030652806 7:112133502-112133524 CGGGTGTATCACTTGAACTAAGG + Intronic
1031203112 7:118716759-118716781 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1031312787 7:120219654-120219676 CAGGTGGATCACTTGAGGCAGGG - Intergenic
1032047458 7:128621640-128621662 CAGGTGGACTACTTGAGGCAAGG + Intergenic
1032054608 7:128674350-128674372 CCGGAGTATCACTTGAAGCCAGG - Intronic
1032413539 7:131718699-131718721 CTGGTGGATCACTTGAGGCTAGG - Intergenic
1032872874 7:136004977-136004999 CAGGTGAATCACTTGAAGCCAGG + Intergenic
1033223032 7:139541234-139541256 CGGGTGGATCACTTGAAGCCAGG - Intronic
1033275001 7:139965123-139965145 CAGGAGAATCACTTGAAGCAGGG + Intronic
1034006378 7:147476697-147476719 CTGGTGGATCACTTGAAGTCAGG + Intronic
1034495336 7:151417525-151417547 CAGGAGAACCACTTGAACCAGGG + Intergenic
1034538299 7:151739696-151739718 CGGGTGGATCACTTGAAGCCAGG - Intronic
1035432934 7:158835919-158835941 CGGGAGAACCACTTGAACCAGGG + Intergenic
1035786890 8:2268605-2268627 CTGGTGGATCACTTGAAGTTAGG + Intergenic
1035805917 8:2453111-2453133 CTGGTGGATCACTTGAAGTTAGG - Intergenic
1035876892 8:3200325-3200347 CTGGTGGATCACTTGAGGCCAGG + Intronic
1036476465 8:9097574-9097596 CTGGAGAATCACTTGAACCAGGG + Intronic
1036638462 8:10567195-10567217 CAGGTGGATCACTTGAAGCCAGG + Intergenic
1037155972 8:15699073-15699095 CTGGAGTATCACTTGAGGCTAGG - Intronic
1037342721 8:17863737-17863759 CAGGTGGACCACTTGAGGCCAGG - Intergenic
1037381541 8:18290095-18290117 CTGGTGAATCACTTGAGGCCAGG + Intergenic
1037460837 8:19107528-19107550 CTGGAGGATCACTTGAAGCCAGG + Intergenic
1037828298 8:22173222-22173244 CTGGAGGATCACTTGAAGCCAGG + Intronic
1037930326 8:22876136-22876158 CTGGTGTATCACTTGAGGCCCGG - Intronic
1038166649 8:25091818-25091840 CAGGAGAACCACTTGAACCAGGG + Intergenic
1038412778 8:27371120-27371142 CGGGTGTATCACTTGAGGCCAGG - Intronic
1038443456 8:27587062-27587084 CGGCTGTCCCACTGGAAGCAGGG - Intergenic
1039563636 8:38533166-38533188 CAGGTGGATCACTTGAAGCCAGG + Intergenic
1039662199 8:39479885-39479907 CTGGAGAACCACTTGAACCCAGG - Intergenic
1039714023 8:40089148-40089170 CAGGAGAACCACTTGAAGCTGGG - Intergenic
1039813343 8:41069861-41069883 CAGGAGTATCACTTGAACCAGGG + Intergenic
1040613509 8:49010624-49010646 CGGGTGTATCACTTGAAGTCAGG - Intergenic
1040919979 8:52605268-52605290 CTGGTGGATCACTTGAAGTCAGG + Intergenic
1040930267 8:52726827-52726849 CTGGAGAATCACTTGAAGCCAGG + Intronic
1041099935 8:54385960-54385982 CTGGTGGATCACTTGAAGCCAGG - Intergenic
1041208214 8:55520356-55520378 CAGGAGGATCACTTGAAGCAAGG + Intronic
1041460686 8:58108552-58108574 CTGGTCTACAACTTGAAGTCAGG - Intronic
1041509600 8:58641146-58641168 CTGGTGGATCACTTGAGGCTAGG - Intronic
1041928635 8:63264428-63264450 CCGGTGGATCACTTGAAGCCAGG - Intergenic
1042838480 8:73099641-73099663 CAGGTGGATCACTTGAAGCCAGG + Intronic
1042846361 8:73172990-73173012 CAGGTGGACCACTTGAGGCCAGG + Intergenic
1042914241 8:73859276-73859298 CAGGGGGACCACTTGAAGCCCGG + Intronic
1043418167 8:80072873-80072895 CAGGTGGATCACTTGAAGCCAGG + Intronic
1043884210 8:85579881-85579903 CTGGTGGATCACTTGAAGTCAGG - Intergenic
1045371811 8:101531840-101531862 CTGATCTACTACTTGAAGCATGG - Intronic
1045383221 8:101647155-101647177 CGGGTGGATCACTTGAAGCCAGG + Intronic
1045444850 8:102250184-102250206 CAGGAGTATCACTTGAACCAGGG - Intergenic
1045493270 8:102686626-102686648 CGGGTGGATCACTTGAAGCCAGG - Intergenic
1045946756 8:107805165-107805187 CTTTTGTACCACTTAGAGCAGGG - Intergenic
1046684124 8:117205708-117205730 CAGGTGGACCACTTGAGGCCAGG + Intergenic
1046742747 8:117846333-117846355 CAGGTGTATCACTTGAGGCCAGG - Intronic
1046749269 8:117909993-117910015 CGGGTGGACCACTTGAAGTCAGG - Intronic
1047067880 8:121306873-121306895 CAGGTGGACCACTTGAAGTCAGG - Intergenic
1047705209 8:127492559-127492581 CTTGTGTGCCATTTGAAGGAAGG - Intergenic
1047764369 8:127978385-127978407 CAGGAGGACCACTTGAAGCCAGG - Intergenic
1049055041 8:140229783-140229805 CTGGTGGATCACTTGAGGCCAGG - Intronic
1049728432 8:144162622-144162644 CAGGTGGACCACTTGAGGCCAGG - Intronic
1050061615 9:1715428-1715450 CGGGTGGACCACTTGAAGTTAGG + Intergenic
1050352391 9:4752840-4752862 CGGGTGGATCACTTGAAGCCAGG + Intergenic
1051172427 9:14332103-14332125 CTGGTGGATCACTTGAAGTCAGG + Intronic
1051710235 9:19923964-19923986 CAGGTGTACCACCTGAAGTAAGG - Intergenic
1051989841 9:23139347-23139369 CTGGTGGATCACCTGAAGCCAGG - Intergenic
1052033738 9:23657254-23657276 CAGGTGGATCACTTGAGGCAAGG + Intergenic
1052635550 9:31099171-31099193 CTGGTGTACCACTTGAGCCCAGG - Intergenic
1052737308 9:32355445-32355467 CAGGTGTATCACTTGAGGCCAGG + Intergenic
1053336576 9:37278956-37278978 CAGGTGGATCACTTGAAGCCAGG + Intronic
1055153085 9:73026616-73026638 CAGGAGTATCACTTGAAGCCAGG + Intronic
1055298579 9:74859543-74859565 CGGGTGGACCACTTGAAGTCAGG + Intronic
1055448419 9:76406811-76406833 CAGGTGAATCACTTGAAGCCAGG + Intergenic
1055545522 9:77368904-77368926 CTGGTGGATCACTTGAGGCCAGG + Intronic
1055570938 9:77616462-77616484 CAGGAGTACCACCAGAAGCAAGG + Intronic
1055601423 9:77923082-77923104 CTGGTGCACCCCTTGAGGCTAGG - Intronic
1055947092 9:81701414-81701436 CAGGAGGACCACTTGAAGCCAGG - Intergenic
1056440796 9:86619171-86619193 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1057019354 9:91684187-91684209 CAGGTGGATCACTTGAAGCCAGG - Intronic
1057622011 9:96644705-96644727 CTGGTGGATCACTTGAGGCCAGG - Intronic
1057919419 9:99084644-99084666 CTGGTGGATCACTTGAAGTCAGG + Intergenic
1058391102 9:104496573-104496595 CAGGAGGACCACTTGAAGCCGGG + Intergenic
1058577877 9:106422794-106422816 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1058720144 9:107756926-107756948 CAGGTGTATCACTTGAGGCCTGG - Intergenic
1058835453 9:108855578-108855600 CTGGTGAACCCGCTGAAGCACGG - Exonic
1058961537 9:109996959-109996981 CAGGTGGACCACTTGAATCCAGG + Intronic
1060163146 9:121385434-121385456 CAGGTGGATCACTTGAAGCTAGG + Intergenic
1060352703 9:122872811-122872833 CTGGTGTATCACTTGAGGTCAGG - Intronic
1060660909 9:125404834-125404856 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1060699151 9:125735723-125735745 CTGGAGAATCACTTGAAGCCAGG - Intergenic
1060845226 9:126831570-126831592 CTGGTGGATCACTTGAAGCCAGG + Intronic
1060928851 9:127475261-127475283 CTGGTGGATCACTTGAGGCCAGG + Intronic
1061276790 9:129573434-129573456 CTGGAGAATCACTTGAACCAAGG - Intergenic
1061342862 9:129997095-129997117 CGGGTGGATCACTTGAAGCCAGG + Intronic
1061768030 9:132894867-132894889 CTGGTGTTCCAGCTGAGGCAGGG - Exonic
1061881280 9:133570472-133570494 CTGGTGTACCACTTGAAGCAGGG - Exonic
1061956797 9:133967702-133967724 CTGGTGGATCACTTGAGGCCAGG + Intronic
1062750304 9:138247384-138247406 CAGGTGGACTACTTGAGGCAAGG + Intergenic
1185782944 X:2864984-2865006 CAGGTGGATCACTTGAAGCCAGG - Intronic
1186098087 X:6124452-6124474 CTGGTGGATCACTTGAGGCCAGG + Intronic
1186178530 X:6950243-6950265 CAGGAGAACCACTTGAACCAGGG + Intergenic
1186562645 X:10629426-10629448 CTGGTGGATCACTTGAGGCCAGG - Intronic
1186749897 X:12610517-12610539 CTGGTGGGTCACTTGAAGCCAGG + Intronic
1186972582 X:14863905-14863927 CAGGCGGACCACTTGAAGCCAGG + Intronic
1187742969 X:22376054-22376076 CGGGTGGACCACTTGAGGTAAGG - Intergenic
1188070195 X:25708952-25708974 CTTGTATATCATTTGAAGCAAGG + Intergenic
1188275858 X:28199472-28199494 CAGGTGGACCACTTGAAGTCAGG + Intergenic
1189482522 X:41403866-41403888 CTGGTGGATCACTTGAAACCAGG - Intergenic
1189718525 X:43890478-43890500 CTGGTGTACAATGTGAAGAATGG - Intergenic
1189748678 X:44196142-44196164 CTGGTGGACCACTTGAGCCCAGG - Intronic
1190104146 X:47546803-47546825 CGGGTGGATCACTTGAAGCCAGG - Intergenic
1190190443 X:48272560-48272582 CTGGAGTATCACTTGAGGCCTGG + Intronic
1190661044 X:52654458-52654480 CTGGTGGATCACTTGAACCCAGG - Intronic
1190691207 X:52915129-52915151 CGGGTGCACCACATGAAACAAGG - Intergenic
1190694776 X:52940663-52940685 CGGGTGCACCACATGAAACAAGG + Intronic
1190911836 X:54778420-54778442 CGGGTGGACCACTTGAAGTCAGG - Intronic
1191669412 X:63735286-63735308 CTGGACTACGACTTGAAGCCAGG + Intronic
1191850756 X:65584246-65584268 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1191860112 X:65659379-65659401 CTGGTGGATCACTTGAGGCCAGG - Intronic
1192030448 X:67506856-67506878 CTGGTGGATCACTTGAGGCCAGG - Intergenic
1192117784 X:68427901-68427923 CTGGTGGATCACTTGAGGCCAGG + Intronic
1192134415 X:68583509-68583531 CGGGAGTATCACTTGAGGCAAGG - Intergenic
1192217320 X:69170857-69170879 CTGGAGAACCACTTGAACCTGGG - Intergenic
1192318719 X:70071331-70071353 CAGGAGAACCACTTGAACCAGGG + Intergenic
1193024456 X:76830388-76830410 CAGGTGAATCACTTGAACCAGGG - Intergenic
1193124892 X:77860552-77860574 CAGGTGTATCACTTGAGGCCAGG + Intronic
1195232313 X:102861956-102861978 CAGGTGGATCACTTGAAGCCAGG - Intergenic
1196202376 X:112900147-112900169 CTGGTGTATCACCTGAAGTCAGG - Intergenic
1197191874 X:123656479-123656501 CAGGTGTATCACTCGAGGCAAGG + Intronic
1198245216 X:134824570-134824592 CGGGTGGATCACTTGAAGCCAGG + Intronic
1198246409 X:134836198-134836220 CAGGAGTACCACTTGAGGCCAGG - Intronic
1199499724 X:148496581-148496603 CGGGTGGATCACTTGAAGCCAGG + Intergenic
1200066869 X:153508135-153508157 CTGGTGTGGCCCTTGAAGTAGGG + Intronic
1200162344 X:154016012-154016034 CTGGTGAGCCCCTTGAGGCAGGG - Exonic
1201605330 Y:15778062-15778084 CAGGTGGATCACTTGAAGCCAGG - Intergenic
1201775574 Y:17661378-17661400 CTGGAGAATCACTTGAACCAGGG - Intergenic
1201825982 Y:18244611-18244633 CTGGAGAATCACTTGAACCAGGG + Intergenic
1202579739 Y:26367305-26367327 CAGGAGAACCACTTGAAGCTGGG - Intergenic