ID: 1061881586

View in Genome Browser
Species Human (GRCh38)
Location 9:133571732-133571754
Sequence ATGCCATGAGCTTCTGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061881577_1061881586 4 Left 1061881577 9:133571705-133571727 CCAGACCCAGCCGCCTCACACCT No data
Right 1061881586 9:133571732-133571754 ATGCCATGAGCTTCTGAGAGGGG No data
1061881572_1061881586 16 Left 1061881572 9:133571693-133571715 CCAGCCCTGGCCCCAGACCCAGC No data
Right 1061881586 9:133571732-133571754 ATGCCATGAGCTTCTGAGAGGGG No data
1061881579_1061881586 -1 Left 1061881579 9:133571710-133571732 CCCAGCCGCCTCACACCTGGCAA No data
Right 1061881586 9:133571732-133571754 ATGCCATGAGCTTCTGAGAGGGG No data
1061881575_1061881586 6 Left 1061881575 9:133571703-133571725 CCCCAGACCCAGCCGCCTCACAC No data
Right 1061881586 9:133571732-133571754 ATGCCATGAGCTTCTGAGAGGGG No data
1061881580_1061881586 -2 Left 1061881580 9:133571711-133571733 CCAGCCGCCTCACACCTGGCAAT No data
Right 1061881586 9:133571732-133571754 ATGCCATGAGCTTCTGAGAGGGG No data
1061881576_1061881586 5 Left 1061881576 9:133571704-133571726 CCCAGACCCAGCCGCCTCACACC No data
Right 1061881586 9:133571732-133571754 ATGCCATGAGCTTCTGAGAGGGG No data
1061881574_1061881586 11 Left 1061881574 9:133571698-133571720 CCTGGCCCCAGACCCAGCCGCCT No data
Right 1061881586 9:133571732-133571754 ATGCCATGAGCTTCTGAGAGGGG No data
1061881582_1061881586 -9 Left 1061881582 9:133571718-133571740 CCTCACACCTGGCAATGCCATGA No data
Right 1061881586 9:133571732-133571754 ATGCCATGAGCTTCTGAGAGGGG No data
1061881581_1061881586 -6 Left 1061881581 9:133571715-133571737 CCGCCTCACACCTGGCAATGCCA No data
Right 1061881586 9:133571732-133571754 ATGCCATGAGCTTCTGAGAGGGG No data
1061881573_1061881586 12 Left 1061881573 9:133571697-133571719 CCCTGGCCCCAGACCCAGCCGCC No data
Right 1061881586 9:133571732-133571754 ATGCCATGAGCTTCTGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061881586 Original CRISPR ATGCCATGAGCTTCTGAGAG GGG Intronic