ID: 1061883520

View in Genome Browser
Species Human (GRCh38)
Location 9:133579488-133579510
Sequence TGGGAAAGGCTACCCCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 95}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061883517_1061883520 -9 Left 1061883517 9:133579474-133579496 CCAGAACCGACATGTGGGAAAGG 0: 1
1: 0
2: 0
3: 2
4: 83
Right 1061883520 9:133579488-133579510 TGGGAAAGGCTACCCCTGACTGG 0: 1
1: 0
2: 1
3: 7
4: 95
1061883509_1061883520 3 Left 1061883509 9:133579462-133579484 CCCGCTCCCACCCCAGAACCGAC 0: 1
1: 0
2: 1
3: 42
4: 863
Right 1061883520 9:133579488-133579510 TGGGAAAGGCTACCCCTGACTGG 0: 1
1: 0
2: 1
3: 7
4: 95
1061883515_1061883520 -7 Left 1061883515 9:133579472-133579494 CCCCAGAACCGACATGTGGGAAA 0: 1
1: 0
2: 1
3: 12
4: 105
Right 1061883520 9:133579488-133579510 TGGGAAAGGCTACCCCTGACTGG 0: 1
1: 0
2: 1
3: 7
4: 95
1061883510_1061883520 2 Left 1061883510 9:133579463-133579485 CCGCTCCCACCCCAGAACCGACA 0: 1
1: 0
2: 0
3: 37
4: 372
Right 1061883520 9:133579488-133579510 TGGGAAAGGCTACCCCTGACTGG 0: 1
1: 0
2: 1
3: 7
4: 95
1061883507_1061883520 14 Left 1061883507 9:133579451-133579473 CCATGCGGCCGCCCGCTCCCACC 0: 1
1: 0
2: 2
3: 21
4: 315
Right 1061883520 9:133579488-133579510 TGGGAAAGGCTACCCCTGACTGG 0: 1
1: 0
2: 1
3: 7
4: 95
1061883508_1061883520 6 Left 1061883508 9:133579459-133579481 CCGCCCGCTCCCACCCCAGAACC 0: 1
1: 0
2: 8
3: 125
4: 1524
Right 1061883520 9:133579488-133579510 TGGGAAAGGCTACCCCTGACTGG 0: 1
1: 0
2: 1
3: 7
4: 95
1061883516_1061883520 -8 Left 1061883516 9:133579473-133579495 CCCAGAACCGACATGTGGGAAAG 0: 1
1: 0
2: 0
3: 24
4: 315
Right 1061883520 9:133579488-133579510 TGGGAAAGGCTACCCCTGACTGG 0: 1
1: 0
2: 1
3: 7
4: 95
1061883513_1061883520 -4 Left 1061883513 9:133579469-133579491 CCACCCCAGAACCGACATGTGGG 0: 1
1: 0
2: 0
3: 10
4: 68
Right 1061883520 9:133579488-133579510 TGGGAAAGGCTACCCCTGACTGG 0: 1
1: 0
2: 1
3: 7
4: 95
1061883511_1061883520 -3 Left 1061883511 9:133579468-133579490 CCCACCCCAGAACCGACATGTGG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1061883520 9:133579488-133579510 TGGGAAAGGCTACCCCTGACTGG 0: 1
1: 0
2: 1
3: 7
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061883520 Original CRISPR TGGGAAAGGCTACCCCTGAC TGG Intronic
900244817 1:1632041-1632063 GGGGCAAGGCTGCCCCTGAAGGG - Intergenic
901744428 1:11363120-11363142 TGGCCAAGGCTACACCTGCCTGG - Intergenic
903737004 1:25536278-25536300 TGGGAAAGGCTTCCCAGGATTGG + Intergenic
907401214 1:54226104-54226126 TGGGAGAGGCTGCCACTGACAGG - Intronic
910583277 1:88851617-88851639 TGGGACAGGTTCTCCCTGACTGG + Intergenic
910633715 1:89383916-89383938 TGGGAAAGGCTCTGCCTGTCTGG - Intronic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
919325082 1:196097449-196097471 TGTAAAAGGCAACCCCTTACTGG + Intergenic
1063574207 10:7246747-7246769 TGAGAGACGCTACCGCTGACAGG + Intronic
1065868570 10:29935483-29935505 TGGGACAGGCAATCCCAGACAGG + Intergenic
1066653514 10:37680466-37680488 TGGGGAATGCTGCCCCTGGCTGG + Intergenic
1067776909 10:49170697-49170719 GGGGAAAGGCTGCCACTGAGTGG - Intronic
1068972923 10:62978042-62978064 TGAGGAAGGTTACCCCTGTCTGG + Intergenic
1069771871 10:70905496-70905518 TGGGAAAGGCTGCTCCTCCCAGG - Intergenic
1071337584 10:84613515-84613537 TGGGAAAAGCTCCTCCTGGCAGG + Intergenic
1074421093 10:113309432-113309454 TGACAAAGGCTATCCCAGACAGG - Intergenic
1075741549 10:124699266-124699288 TGGGACAGGCTGGCGCTGACAGG - Intronic
1076876450 10:133218490-133218512 TGGGAAAGGCGACCCCACCCAGG - Intronic
1077515363 11:2998525-2998547 TTGGAAAAGCCACCCCTGAAAGG - Intergenic
1078932657 11:15924681-15924703 TGGCCAAGGCTTCCCCTGAATGG - Intergenic
1081876777 11:46413965-46413987 TGGAAAAGGCTGGCCCTGATTGG - Intronic
1084904690 11:72336417-72336439 TGGGAGAGGCGGCCCCTCACTGG - Intronic
1085892904 11:80602286-80602308 TGGGAAGGGCTAAACTTGACAGG + Intergenic
1094111883 12:26870764-26870786 TGGGAAAAGCCACCCCAGGCTGG + Intergenic
1095922673 12:47546334-47546356 TGGGAAAGGCTTCCCAGAACAGG - Intergenic
1100489684 12:95067540-95067562 TGGAAAAGGCAACCCATGAATGG - Intronic
1101895321 12:108752121-108752143 TGGGAAAGGCAACAGCTGATGGG - Intergenic
1102071439 12:110023217-110023239 TGGGAAACGCTCCCTCTCACAGG - Intronic
1102298480 12:111754965-111754987 TGGGTGAGGCTGCCCCTGCCTGG - Intronic
1119650024 14:76376836-76376858 CGGGAAAGGCTTTCTCTGACGGG - Intronic
1120714202 14:87822767-87822789 TGGCAAAAGTTTCCCCTGACTGG - Intergenic
1121520894 14:94585585-94585607 TGTGACAGGCTGCCCCTGCCTGG + Intronic
1121607571 14:95252588-95252610 TGGGAATGGCTACACCCAACAGG + Intronic
1125324345 15:38521530-38521552 TGGCAAAGGCTGCCCCCCACAGG + Intronic
1127910206 15:63410593-63410615 TGGAGAAGGCTGCTCCTGACTGG - Intergenic
1132047009 15:98572562-98572584 TTGGAAAGTCCACACCTGACTGG + Intergenic
1132682641 16:1149489-1149511 TGGGACAGGCACGCCCTGACTGG - Intergenic
1133278074 16:4649927-4649949 TGAGAAAGGCTCCACCTGAGGGG - Intronic
1134829648 16:17312964-17312986 TTGGAAAAGCTCCCCCTGGCCGG + Intronic
1137701989 16:50503907-50503929 AGGGAAAGGCTGCCCCTGATGGG - Intergenic
1138352088 16:56351562-56351584 GGGGGAAGCCTGCCCCTGACAGG + Intronic
1140638200 16:76941448-76941470 TGGAGAAGGCAACCCCTGAGGGG - Intergenic
1142302130 16:89265020-89265042 TGGAAATGGCGACCCCTGAATGG + Intergenic
1143261013 17:5598261-5598283 TGGGACAGGCTCCCTCTGCCTGG - Intronic
1143589103 17:7869857-7869879 TGGGAAATGCTAACCCACACTGG - Intronic
1144168357 17:12634317-12634339 TGGTAAATGCAAACCCTGACAGG + Intergenic
1145974842 17:28978012-28978034 TAGGAGAGGGTCCCCCTGACAGG + Intronic
1149282345 17:55121696-55121718 TGAGGCAGGCTACCCCTGAGAGG - Intronic
1149531918 17:57402375-57402397 TGGGACAGTCTCCTCCTGACAGG + Intronic
1151373661 17:73667361-73667383 TGGTTAAATCTACCCCTGACAGG - Intergenic
1162607394 19:11720275-11720297 TAAGAAAGGCTATCTCTGACAGG + Intergenic
1164518842 19:28961239-28961261 AGGGAATGGGTGCCCCTGACTGG - Intergenic
1164920010 19:32082483-32082505 TGGGAAAGGCTCCACGTTACAGG + Intergenic
1165806387 19:38583620-38583642 TGGGAAGGGCTGGCCCTGCCTGG + Intronic
928610645 2:32988693-32988715 TGGGAAAGGCTGATCCTGAAGGG - Intronic
930091019 2:47531533-47531555 TGGGAAAGGCATCCCCTGCTGGG + Intronic
934545143 2:95207886-95207908 GGAGAAAGGCTACCTCTGGCTGG + Intronic
935242505 2:101190788-101190810 TGGGAAACACTACCCCTGACAGG - Intronic
936112472 2:109676285-109676307 TGGGAAAGGCTGCCCTTTAAAGG - Intergenic
941164579 2:162071564-162071586 TGGGAAAGTCTCCCCCTCCCGGG - Intronic
944748366 2:202681881-202681903 TGGAAAAGGCAACATCTGACCGG - Intronic
1170926442 20:20728854-20728876 TGGGAAAAGCAATCCCTGTCAGG + Intergenic
1173310542 20:41892732-41892754 TGGGAAAGGCAGACCCTGATGGG - Intergenic
1174515166 20:51086275-51086297 TGGGAAAGGGAAGCCCTAACTGG - Intergenic
1175971012 20:62686909-62686931 TGGGAAAGGCACCCCCAAACAGG + Intergenic
1176672092 21:9744620-9744642 TGGGACAGACTACCCCTCCCAGG - Intergenic
1178789798 21:35689330-35689352 TGGGAAAGGCCTCTCCTGATGGG - Intronic
1180972455 22:19822586-19822608 TGGGAAAGGCCCCCTGTGACAGG - Intronic
1184189575 22:42885828-42885850 AGGAAAAGGCCACCCCTGCCAGG + Intronic
1184392822 22:44214766-44214788 TGGCCAAGGCTAGCACTGACTGG + Intronic
953914412 3:46909318-46909340 TGGGAAAGGGCACCCCTGGAGGG - Intergenic
958065510 3:88540624-88540646 TGGGAAAGGCTACACGTGTGTGG - Intergenic
959022808 3:101207119-101207141 TAGGAAAGGCAATCCTTGACAGG + Intergenic
968579387 4:1382944-1382966 TCGGGAAGGCCACCCCTGACGGG - Intronic
970540021 4:17068335-17068357 TTGGAAAGACTACCTCTGCCTGG + Intergenic
970929052 4:21487451-21487473 TGGCAAACACTACCCCAGACAGG - Intronic
982228437 4:153186673-153186695 TGGGAAAGGCTTCCCCTTTCGGG - Intronic
985402644 4:189607228-189607250 TGGGACAGACTACCCCTCCCAGG + Intergenic
986174632 5:5341406-5341428 TGGGAAAGGCAAGGCCTGATGGG - Intergenic
986429246 5:7665355-7665377 TGGGAAAGGCCAGCCCTGGCTGG - Intronic
993980466 5:94538487-94538509 TGGGAAATGCTGCCACTGGCTGG + Intronic
994214471 5:97122167-97122189 TGGGGAAGGCAACACCTCACTGG + Intronic
996542138 5:124641379-124641401 TGGAAAAGGCTACAGCTGAGCGG - Exonic
998413063 5:141925525-141925547 TGGGTAAGGCTTCCCCAGCCTGG + Exonic
999649068 5:153747773-153747795 TGGGAAAGGCTACACCCCACTGG - Intronic
1001762249 5:174217798-174217820 TGAGAAAGGGTTCCCCTGAGAGG - Intronic
1003081714 6:3026599-3026621 TGGGGAAGGTTTCTCCTGACAGG - Intergenic
1003134593 6:3424530-3424552 TGGGAGAGGATACCCCTCAATGG - Intronic
1004459453 6:15822027-15822049 AGGCAAAGGCTACCCATGACTGG + Intergenic
1011750470 6:90449986-90450008 TAGGAAAGGGTATCCATGACTGG + Intergenic
1016244231 6:141963880-141963902 TGAGAAAGGCTTCCCATGTCTGG - Intergenic
1017702701 6:157090963-157090985 TGGAAGAGGCTACCCCAGGCGGG - Intronic
1022766558 7:33418723-33418745 TGGGAAAGGCTTCTCCTGCAGGG - Intronic
1031962041 7:127998840-127998862 TGGGGAAGGCCACCAGTGACTGG - Intronic
1031971282 7:128066813-128066835 TGGGCAAGGCTACCACTGCATGG + Intronic
1033130477 7:138741433-138741455 AGGGAAAAGTCACCCCTGACAGG + Intronic
1036789830 8:11710047-11710069 GAGTAAAGGCTACCCCTGCCAGG + Intronic
1040406215 8:47105765-47105787 TGGGAAAGGCTATGCATGTCTGG + Intergenic
1059737015 9:117110986-117111008 TGTGAAAGGCAGGCCCTGACAGG + Intronic
1061883520 9:133579488-133579510 TGGGAAAGGCTACCCCTGACTGG + Intronic
1062619870 9:137415728-137415750 TGGGAAAGCCCACCCTTGATGGG - Intronic
1188043755 X:25401928-25401950 TGGGAAAGTCTACGCATGAGTGG - Intergenic
1195752190 X:108170357-108170379 AGGGAAAGGCTACACATGCCAGG + Intronic
1197864289 X:131001236-131001258 TGGGTAAGGGCAGCCCTGACTGG - Intergenic