ID: 1061883865

View in Genome Browser
Species Human (GRCh38)
Location 9:133581684-133581706
Sequence TTCCAGGCACTGGAGCTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061883858_1061883865 23 Left 1061883858 9:133581638-133581660 CCCATGTTGTTTATTGGAGAAAC 0: 1
1: 0
2: 4
3: 23
4: 243
Right 1061883865 9:133581684-133581706 TTCCAGGCACTGGAGCTGGCCGG No data
1061883854_1061883865 30 Left 1061883854 9:133581631-133581653 CCGCACCCCCATGTTGTTTATTG 0: 1
1: 0
2: 0
3: 33
4: 463
Right 1061883865 9:133581684-133581706 TTCCAGGCACTGGAGCTGGCCGG No data
1061883859_1061883865 22 Left 1061883859 9:133581639-133581661 CCATGTTGTTTATTGGAGAAACT 0: 1
1: 0
2: 0
3: 18
4: 239
Right 1061883865 9:133581684-133581706 TTCCAGGCACTGGAGCTGGCCGG No data
1061883857_1061883865 24 Left 1061883857 9:133581637-133581659 CCCCATGTTGTTTATTGGAGAAA 0: 1
1: 0
2: 3
3: 30
4: 304
Right 1061883865 9:133581684-133581706 TTCCAGGCACTGGAGCTGGCCGG No data
1061883856_1061883865 25 Left 1061883856 9:133581636-133581658 CCCCCATGTTGTTTATTGGAGAA 0: 1
1: 0
2: 0
3: 12
4: 190
Right 1061883865 9:133581684-133581706 TTCCAGGCACTGGAGCTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061883865 Original CRISPR TTCCAGGCACTGGAGCTGGC CGG Intronic
No off target data available for this crispr