ID: 1061884067

View in Genome Browser
Species Human (GRCh38)
Location 9:133582805-133582827
Sequence AGCACTCATGTCTCTACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061884067_1061884078 28 Left 1061884067 9:133582805-133582827 CCTTGGGTAGAGACATGAGTGCT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1061884078 9:133582856-133582878 TGGGGTTTTCAGCCACATGTTGG No data
1061884067_1061884071 4 Left 1061884067 9:133582805-133582827 CCTTGGGTAGAGACATGAGTGCT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1061884071 9:133582832-133582854 CTGTGGCCAGGCTGTAGCCACGG No data
1061884067_1061884072 5 Left 1061884067 9:133582805-133582827 CCTTGGGTAGAGACATGAGTGCT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1061884072 9:133582833-133582855 TGTGGCCAGGCTGTAGCCACGGG No data
1061884067_1061884074 9 Left 1061884067 9:133582805-133582827 CCTTGGGTAGAGACATGAGTGCT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1061884074 9:133582837-133582859 GCCAGGCTGTAGCCACGGGTGGG No data
1061884067_1061884076 10 Left 1061884067 9:133582805-133582827 CCTTGGGTAGAGACATGAGTGCT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1061884076 9:133582838-133582860 CCAGGCTGTAGCCACGGGTGGGG No data
1061884067_1061884070 -8 Left 1061884067 9:133582805-133582827 CCTTGGGTAGAGACATGAGTGCT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1061884070 9:133582820-133582842 TGAGTGCTCAGGCTGTGGCCAGG No data
1061884067_1061884073 8 Left 1061884067 9:133582805-133582827 CCTTGGGTAGAGACATGAGTGCT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1061884073 9:133582836-133582858 GGCCAGGCTGTAGCCACGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061884067 Original CRISPR AGCACTCATGTCTCTACCCA AGG (reversed) Intronic
905082521 1:35336832-35336854 AGTCCTCATGTCTCTACAAAAGG + Intronic
905683710 1:39893553-39893575 AACATTCATGCCTGTACCCATGG + Intergenic
915752887 1:158228452-158228474 AGCACAGAGGTCTCTCCCCAGGG - Intergenic
917619546 1:176782084-176782106 AGCATTCAGGTTTCTACCAATGG - Intronic
922532373 1:226354149-226354171 TGAACTCATGTTTCTGCCCAGGG - Intergenic
923014026 1:230112200-230112222 AGGACTCATGTGTCTACCTGTGG + Intronic
1063055938 10:2504211-2504233 AGCAGTCATTCCTCTATCCAGGG + Intergenic
1067139346 10:43643513-43643535 ATCACTCATGTCTATAGCAAGGG - Intergenic
1070862917 10:79686744-79686766 GGCACCCATGTCCCTTCCCAGGG + Intergenic
1072329643 10:94335149-94335171 AGAATACATGTCTATACCCATGG + Intronic
1078961103 11:16272945-16272967 AGCAATCAAGTCTCTTCTCATGG + Intronic
1082612129 11:55312828-55312850 TGCAATCATGTCTCTTCACAGGG - Intergenic
1083865148 11:65449597-65449619 AGTACACATGTCTCTTCTCAAGG + Intergenic
1098850753 12:75593300-75593322 ACCACTCCTGTATCTTCCCATGG + Intergenic
1104835061 12:131784364-131784386 TCCATTCACGTCTCTACCCACGG - Intronic
1106062882 13:26312106-26312128 AGCACTCTTGTGTCTAGCTACGG + Intronic
1113445042 13:110359430-110359452 TGGACTCATGTATCTACCCTAGG + Intronic
1116864095 14:50017385-50017407 AGCAGCCATGGCTCTGCCCAAGG - Intergenic
1117457761 14:55914809-55914831 AGCAATCATGTCTGTATCCCAGG + Intergenic
1119132582 14:72188122-72188144 AACACTCATATTTCTTCCCAAGG - Intronic
1119464402 14:74843628-74843650 TGTACTTATGTCTCTACCAAAGG - Intronic
1121254451 14:92520915-92520937 AGGACTTATCTCTCTACCGATGG + Intronic
1127259482 15:57317764-57317786 ACCACTCATTTCATTACCCAGGG + Intergenic
1130867341 15:87944080-87944102 AGCACTCACCACCCTACCCAGGG - Intronic
1131217139 15:90547637-90547659 AGCCCTCATGTCTCTAGGCAGGG + Intronic
1131287326 15:91071471-91071493 AGCACTTACCTCTCCACCCATGG + Intergenic
1132102033 15:99030666-99030688 AGCACTGATGAATGTACCCACGG + Intergenic
1133447350 16:5873332-5873354 GGCCCTCTTGTCTCCACCCAAGG + Intergenic
1133935618 16:10267002-10267024 AGCACTCATTTCTGTAGCAATGG + Intergenic
1151987366 17:77552615-77552637 AGAACTCAGTTCTCTACCCTTGG + Intergenic
1158140228 18:54247409-54247431 ATCTCTCATAGCTCTACCCATGG - Intergenic
1158448806 18:57545199-57545221 AGGACCCAGATCTCTACCCAAGG + Intergenic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1164755938 19:30689621-30689643 TGCATCCATGTCTCTTCCCAAGG - Intronic
925794408 2:7526892-7526914 AGGACTCCTGCCTCTTCCCAGGG + Intergenic
926176875 2:10601481-10601503 CGCCCTCATTTCTCTTCCCAGGG + Intronic
929723714 2:44400435-44400457 GGCACTCACCACTCTACCCATGG + Intronic
934520877 2:95019397-95019419 AGCACTCATGGCCCTGCCCATGG + Intergenic
938610071 2:132938354-132938376 TGCACTCATGTGTATACACATGG - Intronic
939104982 2:137938358-137938380 TGCACTCATATCTCAACCAACGG - Intergenic
948107779 2:235428895-235428917 AGCAATCATCTCTCTGTCCAAGG - Intergenic
948280943 2:236747671-236747693 AGCACTCAGGCCTGTCCCCAGGG - Intergenic
1170821810 20:19760488-19760510 AGCACTCTTATCCCCACCCAAGG + Intergenic
1174133878 20:48365362-48365384 AGCTCTCATGTCAGGACCCAGGG - Intergenic
1175867665 20:62189479-62189501 AAGACTCCTGTCTCTACCAAAGG - Intronic
1179170802 21:38971309-38971331 TGCACTCATGTCCCTCCGCAGGG + Intergenic
1181364237 22:22362768-22362790 AGCACTCCCCTCTCTAACCAGGG - Intergenic
1182257220 22:29048086-29048108 CACACTCATGCCTCCACCCAGGG - Intronic
1184816046 22:46871160-46871182 AGGACTCATCTCTCTACTTAAGG - Intronic
952808726 3:37382087-37382109 AGAACTCCTCTCTCTAGCCAAGG - Intergenic
959919452 3:111854921-111854943 AGCATTCTTGCCTCTCCCCAAGG - Intronic
961531054 3:127540701-127540723 AGACATCAAGTCTCTACCCAGGG - Intergenic
961566645 3:127768781-127768803 ATCACTCATGTGTCTACCCCTGG + Intronic
965094658 3:164209572-164209594 ATCATTCCTGTCTCAACCCATGG + Intergenic
966125204 3:176568325-176568347 CGCATTCATGGCTCAACCCATGG - Intergenic
973336862 4:48965468-48965490 AGGACTGGTGTATCTACCCAAGG + Intergenic
975361137 4:73473841-73473863 AGCACTCATCTCTCAACTCCTGG + Intergenic
977000465 4:91492429-91492451 AGCACTGCTGTCTCTTCCCAGGG + Intronic
978541609 4:109822196-109822218 AGAAATTAAGTCTCTACCCAGGG + Intronic
981398209 4:144279634-144279656 TGCACTCATGTCCCTTCTCATGG + Intergenic
982146482 4:152400363-152400385 AAAAGTCATGTCTATACCCAAGG - Intronic
984559257 4:181249705-181249727 AGCACTCATCTATGTTCCCATGG - Intergenic
989632968 5:43505969-43505991 AGCACACATGTGTATACACATGG - Exonic
989714374 5:44443633-44443655 AGCAGTCATGTCTCATTCCATGG + Intergenic
990872107 5:60443500-60443522 AGCATTCTTTTCTCTACCCTGGG - Intronic
992186568 5:74250249-74250271 AGCACCCTTGTGTCTCCCCATGG - Intergenic
994107076 5:95960756-95960778 AGTCCTCAGGTCTCTCCCCAGGG + Intronic
997612923 5:135227732-135227754 ACCACTCATGCCCTTACCCATGG - Intronic
1003067751 6:2918079-2918101 AGCACTCATGACTCTCCAGACGG - Intergenic
1003227017 6:4215212-4215234 AGCAAACATGTCCCTTCCCACGG + Intergenic
1006139907 6:31922123-31922145 AGCATCTCTGTCTCTACCCAAGG - Intronic
1008534528 6:52497794-52497816 AACACTCAAATCTGTACCCAAGG + Exonic
1013166968 6:107603364-107603386 AGGACAAATGTCTCTGCCCAAGG + Intronic
1016916500 6:149248851-149248873 AGCAGTCATGTCCCCACCCCCGG + Intronic
1018206752 6:161443739-161443761 AGCACACTTGTTTCTACCAAAGG - Intronic
1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG + Intronic
1022408728 7:30119039-30119061 AGCAGTCATGTCTGTACCACGGG - Intronic
1023113931 7:36841880-36841902 AGCACTTAGGTCACTTCCCAAGG - Intergenic
1026494394 7:70890036-70890058 AGAGCTCAGGTCTCCACCCAAGG - Intergenic
1030790843 7:113726588-113726610 AGTATTCATGTCTCTGACCAGGG - Intergenic
1032779365 7:135151299-135151321 TGGACTCATGTTTCTACCAAAGG + Intronic
1035685959 8:1523555-1523577 AGGACTCAATTTTCTACCCAGGG - Intronic
1035710813 8:1712514-1712536 AGCACTCAAGTCTCTGCTAAGGG + Intergenic
1037121811 8:15297931-15297953 TGCACTCATGTCTGCAGCCAAGG + Intergenic
1049328445 8:142037054-142037076 AGCATTCCTGTCTCTGCCCCTGG - Intergenic
1051756502 9:20406587-20406609 AGCACTGAGGTCTCAAACCAGGG + Intronic
1055664615 9:78540946-78540968 AGCTCATATGTCTCTCCCCATGG + Intergenic
1058975820 9:110124645-110124667 GACACTGATGTCTCTACTCAAGG + Intronic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1193366204 X:80637176-80637198 AGCAGAAATGTCTCTCCCCATGG + Intergenic
1194775197 X:97954576-97954598 ATCAGTAATGTCTCTAGCCATGG + Intergenic
1195048730 X:101078257-101078279 ACCACTCATCTATCTACTCACGG - Intergenic
1195173912 X:102296573-102296595 AGCATTCATATTTCTACCAACGG - Intergenic
1195184953 X:102390520-102390542 AGCATTCATATTTCTACCAACGG + Intronic
1200152415 X:153957700-153957722 AGAACTCATGTCCCTGCCCATGG - Intronic
1201548312 Y:15191257-15191279 AGCACTCATTTCTCTACTGAAGG - Intergenic