ID: 1061884071

View in Genome Browser
Species Human (GRCh38)
Location 9:133582832-133582854
Sequence CTGTGGCCAGGCTGTAGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061884063_1061884071 21 Left 1061884063 9:133582788-133582810 CCCTGCTGGTCGCTTGACCTTGG 0: 1
1: 0
2: 7
3: 59
4: 408
Right 1061884071 9:133582832-133582854 CTGTGGCCAGGCTGTAGCCACGG No data
1061884065_1061884071 20 Left 1061884065 9:133582789-133582811 CCTGCTGGTCGCTTGACCTTGGG 0: 1
1: 0
2: 3
3: 35
4: 300
Right 1061884071 9:133582832-133582854 CTGTGGCCAGGCTGTAGCCACGG No data
1061884067_1061884071 4 Left 1061884067 9:133582805-133582827 CCTTGGGTAGAGACATGAGTGCT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1061884071 9:133582832-133582854 CTGTGGCCAGGCTGTAGCCACGG No data
1061884062_1061884071 26 Left 1061884062 9:133582783-133582805 CCGGTCCCTGCTGGTCGCTTGAC 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1061884071 9:133582832-133582854 CTGTGGCCAGGCTGTAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061884071 Original CRISPR CTGTGGCCAGGCTGTAGCCA CGG Intronic
No off target data available for this crispr