ID: 1061884078

View in Genome Browser
Species Human (GRCh38)
Location 9:133582856-133582878
Sequence TGGGGTTTTCAGCCACATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061884075_1061884078 -5 Left 1061884075 9:133582838-133582860 CCAGGCTGTAGCCACGGGTGGGG 0: 1
1: 0
2: 0
3: 17
4: 156
Right 1061884078 9:133582856-133582878 TGGGGTTTTCAGCCACATGTTGG No data
1061884067_1061884078 28 Left 1061884067 9:133582805-133582827 CCTTGGGTAGAGACATGAGTGCT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1061884078 9:133582856-133582878 TGGGGTTTTCAGCCACATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061884078 Original CRISPR TGGGGTTTTCAGCCACATGT TGG Intronic
No off target data available for this crispr