ID: 1061884307

View in Genome Browser
Species Human (GRCh38)
Location 9:133583923-133583945
Sequence TCTGATGTCAGGCTGGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061884307_1061884314 21 Left 1061884307 9:133583923-133583945 CCAGCGCCCAGCCTGACATCAGA 0: 1
1: 0
2: 1
3: 14
4: 215
Right 1061884314 9:133583967-133583989 TCCCAAAAACACGGCCTCCCTGG No data
1061884307_1061884316 22 Left 1061884307 9:133583923-133583945 CCAGCGCCCAGCCTGACATCAGA 0: 1
1: 0
2: 1
3: 14
4: 215
Right 1061884316 9:133583968-133583990 CCCAAAAACACGGCCTCCCTGGG No data
1061884307_1061884313 12 Left 1061884307 9:133583923-133583945 CCAGCGCCCAGCCTGACATCAGA 0: 1
1: 0
2: 1
3: 14
4: 215
Right 1061884313 9:133583958-133583980 CCGAGCAGCTCCCAAAAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061884307 Original CRISPR TCTGATGTCAGGCTGGGCGC TGG (reversed) Intronic
900555921 1:3280460-3280482 TCTGGTGTGAGGTTGGACGCTGG - Intronic
900582368 1:3415467-3415489 TGTGAACTCAGCCTGGGCGCAGG - Intronic
904308929 1:29612828-29612850 TATGCGTTCAGGCTGGGCGCTGG + Intergenic
905106212 1:35565111-35565133 TCTGATTCCAGGCTGTGCCCTGG + Intronic
906102196 1:43270870-43270892 ACGGGTGTCAGGCTGGGGGCGGG - Intronic
908440983 1:64154215-64154237 TCAGTTGGCAGGCTGGGCCCAGG - Intronic
909482798 1:76143666-76143688 TTTGATGTCAGCATGGGCGTGGG - Intronic
911466918 1:98266396-98266418 TCTGATGTCAGTCTGAGTGGAGG + Intergenic
912942603 1:114058549-114058571 ACGGATGTCAGGCTGGGGGATGG - Intergenic
913485228 1:119327577-119327599 TGTGATGTCAAGCTGGGCAGAGG + Intergenic
914719799 1:150280553-150280575 TCTGATGTATGGCAGGGCGGTGG + Intronic
915726936 1:158024779-158024801 TCTGAGGTCAGGGTGGACCCTGG - Intronic
916835873 1:168544257-168544279 TCTGAATTCAGGCTGGTGGCAGG - Intergenic
916838595 1:168576317-168576339 TCTGAATTCAGGCTGGTGGCAGG + Intergenic
917291272 1:173474825-173474847 ACTGGTGTCAGGCTGGGAGACGG - Intergenic
922030662 1:221794422-221794444 TCTGATGTCATGCTGGTGGCAGG + Intergenic
923104406 1:230843391-230843413 CCTGATGTCAGGCAGGACGATGG - Exonic
924092601 1:240516888-240516910 GCTGATTTCAGTCTGGGCCCTGG + Intronic
924934689 1:248758001-248758023 TCTGGTGTCAGGCTGAGTACTGG + Intergenic
1066206000 10:33189818-33189840 TCTAATGTCAGTCTATGCGCGGG + Intronic
1067333420 10:45342126-45342148 TCAGATGTCAAGCTGTGTGCTGG - Intergenic
1067344797 10:45429274-45429296 CCTGCTGCCAGGCTGGGAGCTGG + Intronic
1067783783 10:49227963-49227985 TCTGCTGTCCGGCTGAGTGCTGG + Intergenic
1069590289 10:69637238-69637260 TCTGGTTTGAGGCTGGGGGCAGG + Intergenic
1073724383 10:106212683-106212705 TCTGTTGCCAGGCTGGAGGCTGG - Intergenic
1073985688 10:109206053-109206075 TGTGATATCAGTCTGGTCGCAGG - Intergenic
1074832890 10:117262250-117262272 TCTGATGTCAGGCTTGGTTTGGG - Intronic
1077329411 11:1977371-1977393 TCGGCTGTCAGGCGGGCCGCAGG + Intronic
1082716376 11:56618899-56618921 ACGGGTGTCAGGCTGGGGGCCGG + Intergenic
1086586930 11:88463324-88463346 TCAGATCTCAGGCTGCGTGCTGG + Intergenic
1091266506 11:134276121-134276143 TCTGCTGTGAGGCTGTGCTCGGG + Intronic
1202812391 11_KI270721v1_random:32550-32572 TCGGCTGTCAGGCGGGCCGCAGG + Intergenic
1095423377 12:42048975-42048997 TCAGATCTCAAGCTGGGTGCTGG + Intergenic
1104608285 12:130205730-130205752 GCTGTTGGCAGGCTGGGCGTGGG - Intergenic
1104617478 12:130282846-130282868 TGTAATTTCAGGCCGGGCGCGGG + Intergenic
1105896355 13:24719901-24719923 GCTGAGCTCAGGCTGGGGGCGGG + Intergenic
1106579879 13:31008430-31008452 TCTTATGTCAGGCTGGTGTCTGG - Intergenic
1108114421 13:47111239-47111261 TCTGCTGTCAGGGAGGGCTCCGG + Intergenic
1109779679 13:67092871-67092893 TCTGATGGCTGGCTGGGCCTCGG - Intronic
1110596523 13:77326556-77326578 GCTGCTGTCAGGCCGGGCCCTGG - Exonic
1117313551 14:54552277-54552299 TCTCCTGTCAGCCTGGGAGCAGG + Intergenic
1118288927 14:64503498-64503520 TGAGATGTCAGGCAGGGCACAGG - Intronic
1119425470 14:74532050-74532072 TCTGATGTCTGGCTGAGCCTTGG - Intronic
1121507834 14:94490096-94490118 TCTGGGGTCAGGATGGGCTCAGG - Intronic
1122929312 14:104926126-104926148 TCTGCAGCCAGGCTGGGCGCTGG - Intronic
1123167092 14:106335701-106335723 TCTGAGGAGAGGCTGGGCTCAGG + Intergenic
1123169709 14:106360412-106360434 TCTGAGGAGAGGCTGGGCTCAGG + Intergenic
1123199026 14:106643752-106643774 TCTGAGGAGAGGCTGGGCTCAGG + Intergenic
1125681926 15:41536363-41536385 CCTGAGGTCAGGTTGGGGGCTGG - Intronic
1128052887 15:64678996-64679018 TCTGAAGTCAGACTGGGGGGAGG + Intronic
1130775598 15:86978682-86978704 TCTGGGGTCAGGCTGTGAGCTGG + Intronic
1132042553 15:98537215-98537237 TCTGAAGTGAGGCTGGGGTCTGG - Intergenic
1132766515 16:1537112-1537134 TGTGCTGTGAGGCTGGGTGCTGG + Intronic
1133901211 16:9976827-9976849 TGTGGTGTCAGGCTGGCCACCGG - Intronic
1134133126 16:11663267-11663289 GCTGAGGGCAGGCTGGGGGCAGG + Intergenic
1134671540 16:16059513-16059535 TATGAAATCTGGCTGGGCGCAGG + Intronic
1134880252 16:17739972-17739994 GCTGGGGTCAGGCTGGGAGCAGG + Intergenic
1136147343 16:28323121-28323143 TCTGGGGTCAGGCTGGAGGCTGG - Exonic
1137644533 16:50062609-50062631 TCAAAACTCAGGCTGGGCGCGGG - Intergenic
1138039821 16:53651041-53651063 GGTGATGTCAGGCTGGTGGCTGG - Intronic
1140410190 16:74736560-74736582 TGTTATGTCAGGCAGGGGGCAGG + Intronic
1141370024 16:83478378-83478400 TCTGTGGTCAGACTGGGAGCTGG - Intronic
1141557227 16:84844214-84844236 TCTGAAGACAGGCTGGCCCCAGG - Intronic
1142218881 16:88843137-88843159 GCTGGTGTCAGGCTGGGAGGAGG - Intronic
1142323344 16:89399315-89399337 TCTGTTGTCTGGATGGACGCCGG - Intronic
1142625909 17:1191781-1191803 CCTGACGGCAGCCTGGGCGCAGG - Intronic
1142983723 17:3685781-3685803 CCTGTTCTCAGGCTGGGCGGGGG - Intronic
1142983776 17:3685918-3685940 CCTGTTCTCAGGCTGGGCGGGGG - Intronic
1143345319 17:6244892-6244914 GCTGATCTCAGGCTGTTCGCTGG - Intergenic
1144642163 17:16943625-16943647 GCTGATGTCCTGCTGGGGGCAGG - Intronic
1145303231 17:21654900-21654922 CCTGATGTCAACCTGGGAGCTGG - Intergenic
1145346807 17:22046942-22046964 CCTGATGTCAACCTGGGAGCTGG + Intergenic
1146768356 17:35544815-35544837 TCTTAAATCAGGCTGGGCGCAGG - Intergenic
1146927902 17:36757640-36757662 TCTTCTGTCTGGCTGGGCCCAGG + Intergenic
1148123535 17:45225472-45225494 TCTGATGTTGGGCTGGGCAGAGG + Intronic
1148751969 17:49950547-49950569 TTTGATCTGAGGCTGGGGGCGGG + Intergenic
1149125472 17:53225096-53225118 TCTGTTGCCAGGCTGGAGGCTGG - Intergenic
1149495814 17:57116666-57116688 TCTGAGGTCAGGCTTGCAGCAGG + Intronic
1150877800 17:68988699-68988721 TCTGGTGTCATGCTGGGTGAGGG + Intronic
1151187789 17:72376483-72376505 TCTGATTTCAGGCTGCGAGGTGG - Intergenic
1152261409 17:79269274-79269296 TCTGAAGTCAGGGTGTGGGCAGG - Intronic
1152625333 17:81385572-81385594 TCTGATGTCAGGCCGGCTGGGGG - Intergenic
1154485960 18:14871347-14871369 TCTGAGGACAGGATGGGCACAGG + Intergenic
1156204417 18:34870696-34870718 TCTGGTGTCAGGCTGGCTGCTGG - Intronic
1157409887 18:47454741-47454763 TCTGACGGCAGGCAGGGCTCAGG + Intergenic
1160420773 18:78742420-78742442 CCTGCTGTTAGGGTGGGCGCTGG - Intergenic
1160553799 18:79713526-79713548 GCAGTGGTCAGGCTGGGCGCTGG + Intronic
1160688405 19:448300-448322 TCTGAGGTCAAGCTGCGGGCAGG + Intronic
1162782307 19:13012638-13012660 TCGGATGTCAGGATGGGCGCAGG - Intronic
1163851439 19:19666331-19666353 TCTGTTGTCAGGCTGGAGGCTGG + Intergenic
1164550327 19:29205643-29205665 TCTGATGTCAGGGTGCTAGCTGG + Exonic
1166144177 19:40823009-40823031 ACTGGTGTCAGGCTGGGGGATGG - Intronic
1168096767 19:54120269-54120291 CCTGATGTCAGGCCAGGCTCAGG + Intronic
925702037 2:6648341-6648363 TCTCAAGGCAGGCTGGGCGTGGG - Intergenic
925725112 2:6864980-6865002 TCAGATGCCACGCTGGGAGCTGG + Intronic
925929494 2:8695465-8695487 TGTGTGGTCAGGCCGGGCGCAGG - Intergenic
926200433 2:10792405-10792427 TCTGTTGCCAGGCAGGGTGCAGG + Intronic
926786422 2:16522589-16522611 GCTGATGCCAGGCTGGGCAGTGG - Intergenic
926992738 2:18697668-18697690 TCAGATGTCAAGCTGCGTGCTGG + Intergenic
930155687 2:48105590-48105612 TCTGTTCTCAGTCTGGGTGCTGG + Intergenic
930868133 2:56142617-56142639 TCAGATCTCAAGCTGGGTGCTGG + Intergenic
935562423 2:104572893-104572915 TCAGATGTCAGGCATGGGGCTGG + Intergenic
935858294 2:107299302-107299324 TCAGATCTCAGGCTGGGTGCTGG + Intergenic
936025334 2:109027344-109027366 TCTGGGGTCTGGCTGGGCCCAGG - Intergenic
936158942 2:110069802-110069824 CCTCATGACAGGCTGGGCCCTGG - Intergenic
936185718 2:110301530-110301552 CCTCATGACAGGCTGGGCCCTGG + Intergenic
941288754 2:163648288-163648310 TCTGAGGTGAGGCTGGGAGTTGG - Intronic
942438024 2:176002215-176002237 TCTGGAGGCAGGCTGGGCGGTGG - Exonic
943681951 2:190777734-190777756 TCAGATCTCAAGCTGGGTGCTGG + Intergenic
946890412 2:224269924-224269946 TCTGAGGTCAGGCTGTTGGCAGG - Intergenic
946946135 2:224824721-224824743 TCAGAAGTAAGGCTGGGCACGGG - Intronic
948790541 2:240374385-240374407 TCTGATGCCAGCCTGGGGCCTGG + Intergenic
1168889682 20:1286818-1286840 TCTGATCTCAGGCTGGGTGGGGG + Intronic
1169975738 20:11325300-11325322 TTTGGTGTCTGGCTGGGTGCTGG + Intergenic
1171389908 20:24794712-24794734 TCTGTTGTAAGGCTGGGCTGTGG - Intergenic
1171520747 20:25772591-25772613 CCTGATGTCAACCTGGGAGCTGG - Intronic
1171814125 20:29768347-29768369 TCAGATCTCAAGCTGTGCGCTGG - Intergenic
1172138897 20:32707779-32707801 TGTAATGTCAGGTTGGGCACAGG + Intronic
1172447502 20:35000888-35000910 ACTGATGTGAGGCTGGGCAAGGG + Exonic
1172903832 20:38354496-38354518 TCGGAGGCCAGGCTGAGCGCTGG - Intronic
1173187625 20:40853182-40853204 TCTGATGAGAGGATGGGGGCTGG + Intergenic
1173364580 20:42373250-42373272 TATGCTGCCAGGCTGGGCTCTGG + Intronic
1173799590 20:45886742-45886764 GCAGATATCAGGCTGGGAGCTGG + Exonic
1175866290 20:62178922-62178944 TCTGATGCCAGGCCTGGCACAGG + Intronic
1176128179 20:63485242-63485264 TCTGATGCCTGGCAGGGCTCCGG - Intergenic
1176654611 21:9577696-9577718 CCTGATGTCAACCTGGGAGCTGG - Intergenic
1176888158 21:14281493-14281515 ACTGGTGTCAGGCTGGGGGACGG + Intergenic
1180100373 21:45581192-45581214 TCTGAAATCCGTCTGGGCGCAGG - Intergenic
1182157053 22:28084172-28084194 TCAGATCTCAGGCTGTGTGCTGG - Intronic
1182360683 22:29744706-29744728 TCTGATGTGTGGCTGGGGTCAGG - Intronic
1182809754 22:33105755-33105777 TCTTAAGCCAGGCTGGGAGCAGG + Intergenic
1183324773 22:37185246-37185268 TCTGATCTCAGGCAGGGCGTGGG + Exonic
1183379893 22:37485566-37485588 CCTGATGCCAGGCTGGGCCTGGG + Intronic
1183742013 22:39674071-39674093 ATTGGTGTCAGGCTGGGCCCTGG + Intronic
1184086696 22:42270110-42270132 TCTGATGCCAGGCCTGGCCCGGG + Intronic
1184556981 22:45238800-45238822 TCTGAGGTCAGGCTGGCAGAGGG + Intronic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
950530224 3:13548902-13548924 TCAGAGGTTAGGCCGGGCGCAGG + Intergenic
950923128 3:16715483-16715505 TATGTGGTCAGGCTGGGCCCTGG + Intergenic
953023404 3:39130353-39130375 ACTGAGGTCAGGCTGGGCTAGGG + Exonic
953901994 3:46848795-46848817 TCTGACCTCAGGCTGCACGCTGG - Intergenic
954618196 3:51981031-51981053 GCTCATGCCAGGCTGGGAGCTGG - Exonic
955015728 3:55066892-55066914 TATGATGTCAGCCTGGCTGCTGG + Intronic
955135513 3:56213676-56213698 TCAGATGTCAAGCTGCGTGCTGG - Intronic
959202205 3:103261505-103261527 TTTGATGTTAGGCTGGGGGTGGG - Intergenic
959459240 3:106604385-106604407 TCAGCTGTCAGGCTGGGCATAGG + Intergenic
966635954 3:182133961-182133983 TCTGCTGTCAGGCTGAGCAAAGG - Intergenic
969414835 4:7051396-7051418 TCCAATGTCTGGCTGGGTGCTGG + Intronic
970226323 4:13861011-13861033 TCTGATGACTGCCTGGGCACAGG - Intergenic
971072838 4:23114088-23114110 TTTGATGGCAGGCTGGGAGCTGG - Intergenic
985483896 5:138071-138093 TCTGACGTCAGGGTGGGCCCTGG - Intergenic
985993252 5:3580835-3580857 TCTGGTGTCAGGCAGGGTGATGG + Intergenic
990437563 5:55808796-55808818 TCAGATGTCTGGCTGCGTGCTGG + Intronic
992067471 5:73120752-73120774 TGTGCGGCCAGGCTGGGCGCGGG + Intronic
994094833 5:95839247-95839269 GTTGATGTGAGGCTGGGCGATGG + Intergenic
995338528 5:111030378-111030400 TCAGATCTCAAGCTGGGTGCTGG - Intergenic
995633778 5:114162482-114162504 TCAGATCTCAGGCTGTGTGCTGG + Intergenic
997117221 5:131138394-131138416 TCAGATGTCCGGCTGTGTGCTGG + Intergenic
998665898 5:144297370-144297392 TCTGAAGTCAGGATGGGTTCAGG + Intronic
998817971 5:146032670-146032692 TAGGATGTCAGGCTGGGCTTTGG - Intronic
999867728 5:155719418-155719440 TCAGATCTCAGGCTGCGTGCTGG + Intergenic
1001487693 5:172131321-172131343 GCTGATGACAGGCCAGGCGCGGG - Intronic
1001982629 5:176047174-176047196 TCTGATGTCCGCCTGGGGCCTGG + Intergenic
1002234834 5:177796883-177796905 TCTGATGTCCGCCTGGGGCCTGG - Intergenic
1002275916 5:178104475-178104497 TCTGAGGACAGGGTGGGCACAGG - Intergenic
1002375955 5:178789346-178789368 GCTGATGTGAGACTGGGGGCAGG - Intergenic
1002536788 5:179880188-179880210 TGTGATGTTGGGCTGGGCTCAGG + Intronic
1002943268 6:1736131-1736153 CCTGATGTCATGCTGGGCTGTGG - Intronic
1007421732 6:41723809-41723831 TCTGAGGTCAGGCTGGGGTCAGG - Intronic
1010452167 6:76015303-76015325 TCTGATGGCAGGCTGTGAGGTGG + Intronic
1010512608 6:76739004-76739026 TCTGAAGGCAGGCTGGGTGTGGG + Intergenic
1011716277 6:90108584-90108606 TCTGATCTCAGGCTGATCTCAGG - Intronic
1013464674 6:110407497-110407519 TTTGATGTCAGGCTGCCCACTGG - Intronic
1013867847 6:114720523-114720545 TGTGTTATGAGGCTGGGCGCAGG - Intergenic
1014131635 6:117840724-117840746 TCTGATGTCAGGTGGGCTGCTGG - Intergenic
1015096298 6:129417851-129417873 TCTGAAATCAGCCTGGGTGCCGG + Intronic
1015729024 6:136329404-136329426 GCTGATGATAGGCTGGGAGCAGG - Intergenic
1017202530 6:151771461-151771483 TCTTGTGGCAGGCTGGCCGCCGG + Intronic
1018053325 6:160030410-160030432 TCTGACGTCAGGCTGGCAGCTGG + Intronic
1018060227 6:160084371-160084393 TCTGAGGTCAGAGTGGGGGCAGG + Intronic
1018748729 6:166782717-166782739 TCTGACGTCAGGTAGGGCCCCGG - Intronic
1018969135 6:168513922-168513944 TCTGAAGACAGGCCGGGCGTTGG - Intronic
1019530411 7:1500239-1500261 GGTGCTGTCAGGCTTGGCGCGGG + Exonic
1019638822 7:2091434-2091456 GCTGATGTCTGGCTGGGGTCTGG + Intronic
1019710677 7:2516918-2516940 TCGGAAGGCAGGCTGGGCCCTGG + Intronic
1021606471 7:22414114-22414136 TCTGGTGTCAGCCTGGGCCGAGG - Intergenic
1022473532 7:30695788-30695810 TCTGGAGTCAGGCTGTGGGCCGG + Intronic
1024131743 7:46360513-46360535 GCTGATGTCAGGCTCAGCGGAGG + Intergenic
1024235016 7:47391349-47391371 TCTGATGCTGGGGTGGGCGCAGG - Intronic
1024981199 7:55159010-55159032 TCTGACCCCAGGCTGGGGGCTGG - Intronic
1025281237 7:57627554-57627576 CCTGATGTCAACCTGGGAGCTGG - Intergenic
1025303492 7:57837953-57837975 CCTGATGTCAACCTGGGAGCTGG + Intergenic
1025936869 7:66044554-66044576 TCTGAAGTCGGCCTGGGCGAAGG - Intergenic
1026552310 7:71379126-71379148 CCTGATACCAGGCTGGGCTCTGG + Intronic
1033285095 7:140034660-140034682 TTTGATCTCAGGCTGGGCTGAGG - Intronic
1033669617 7:143478543-143478565 TCTGGTGTGAGCCTGGGTGCTGG - Exonic
1035682138 8:1495901-1495923 TCTCGGGACAGGCTGGGCGCCGG - Intergenic
1038406523 8:27326341-27326363 CCTGCTGTCAGGCTGCGCGTGGG + Intronic
1039937748 8:42062148-42062170 TCTGTTGCCAGGCTGGAGGCTGG - Intergenic
1043546156 8:81318063-81318085 TCTGAGCTGAGGCTGGGTGCTGG + Intergenic
1044629774 8:94267014-94267036 TCTGATGAGAAGCTGGGGGCTGG - Intergenic
1044800121 8:95945306-95945328 CCTGAAGCCAGGCTGGGCTCTGG + Intergenic
1044833803 8:96276581-96276603 TTTGATGTCAGCCTGTTCGCAGG + Intronic
1044999641 8:97868837-97868859 TCTGATGCCCGCCTGGGCTCAGG + Intronic
1045307010 8:100966502-100966524 TCTGTTGTCAGGCTGGAGTCTGG - Intergenic
1046007661 8:108505777-108505799 TCAGATCTCAGGCTGCGTGCTGG + Intergenic
1047356060 8:124123395-124123417 TCTGATGCCAGACTGGGTACAGG - Intergenic
1048454981 8:134569644-134569666 TCTGCTGTGAGGATGGGCTCAGG + Intronic
1053886877 9:42650168-42650190 TCTGAGGACAGGATGGGCACAGG + Intergenic
1054225896 9:62457618-62457640 TCTGAGGACAGGATGGGCACAGG + Intergenic
1056731681 9:89171404-89171426 TCTGATGTGAGGCTGGGTGAAGG + Intronic
1057501166 9:95597577-95597599 ACTGATGTCTGGCTTGACGCTGG + Intergenic
1057833015 9:98420888-98420910 TCTGAAGGCAGGCAGGGAGCAGG + Intronic
1058785497 9:108382633-108382655 TCTGATGTCAGGGAGTGTGCTGG - Intergenic
1059859118 9:118437917-118437939 TTTTATGTCAGGTTGGGCGTTGG + Intergenic
1061149939 9:128822885-128822907 ACTGAAGACAGGCTGGGAGCGGG - Intronic
1061586671 9:131573963-131573985 TCAGATCTCAGGCAGGGGGCTGG + Intergenic
1061802788 9:133121262-133121284 GCTGATGTCAGGCTGGGGGGCGG + Intronic
1061884307 9:133583923-133583945 TCTGATGTCAGGCTGGGCGCTGG - Intronic
1062031795 9:134365161-134365183 GCTGATGGCACGCTGGGCCCGGG + Intronic
1203632331 Un_KI270750v1:81154-81176 CCTGATGTCAACCTGGGAGCTGG - Intergenic
1186571107 X:10715706-10715728 TCAGATCTCAAGCTGTGCGCTGG - Intronic
1187777379 X:22777069-22777091 TATGATGTCAGGCACGGAGCAGG - Intergenic
1190109764 X:47582451-47582473 TCTGGTGTCTCTCTGGGCGCTGG - Exonic
1191625510 X:63266555-63266577 TCAGATCTCAAGCTGGGTGCTGG + Intergenic
1194879624 X:99235260-99235282 TCAGATCTCAGGCTGTGTGCTGG - Intergenic
1194944511 X:100051425-100051447 TCAGATCTCAGGCTGCGTGCTGG - Intergenic
1198319847 X:135510033-135510055 ACTGATGTCAGGCTGGTGACAGG + Intergenic
1199867231 X:151863197-151863219 CCAGATGTCAGGCTGGACTCTGG + Intergenic
1200216549 X:154370620-154370642 TGTGAGTTCAGCCTGGGCGCCGG + Intronic
1201150294 Y:11091912-11091934 TCTCATGTCCACCTGGGCGCTGG - Intergenic