ID: 1061884495

View in Genome Browser
Species Human (GRCh38)
Location 9:133584788-133584810
Sequence CCTCGGAGGCAGAGCCATGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061884488_1061884495 8 Left 1061884488 9:133584757-133584779 CCTGTTGGTGCTGGGAACAGCAC 0: 1
1: 0
2: 1
3: 9
4: 161
Right 1061884495 9:133584788-133584810 CCTCGGAGGCAGAGCCATGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061884495 Original CRISPR CCTCGGAGGCAGAGCCATGC GGG Intronic
No off target data available for this crispr