ID: 1061884965

View in Genome Browser
Species Human (GRCh38)
Location 9:133586791-133586813
Sequence GTGGCAGTCCTGAGAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061884965_1061884968 -8 Left 1061884965 9:133586791-133586813 CCTGCCTTTCTCAGGACTGCCAC No data
Right 1061884968 9:133586806-133586828 ACTGCCACCCAACCATGTCAGGG No data
1061884965_1061884967 -9 Left 1061884965 9:133586791-133586813 CCTGCCTTTCTCAGGACTGCCAC No data
Right 1061884967 9:133586805-133586827 GACTGCCACCCAACCATGTCAGG No data
1061884965_1061884969 -7 Left 1061884965 9:133586791-133586813 CCTGCCTTTCTCAGGACTGCCAC No data
Right 1061884969 9:133586807-133586829 CTGCCACCCAACCATGTCAGGGG No data
1061884965_1061884977 30 Left 1061884965 9:133586791-133586813 CCTGCCTTTCTCAGGACTGCCAC No data
Right 1061884977 9:133586844-133586866 ATGGCCTCAGCCAGGCTTTGCGG No data
1061884965_1061884974 11 Left 1061884965 9:133586791-133586813 CCTGCCTTTCTCAGGACTGCCAC No data
Right 1061884974 9:133586825-133586847 AGGGGTTGTAAGAACCAGCATGG No data
1061884965_1061884975 22 Left 1061884965 9:133586791-133586813 CCTGCCTTTCTCAGGACTGCCAC No data
Right 1061884975 9:133586836-133586858 GAACCAGCATGGCCTCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061884965 Original CRISPR GTGGCAGTCCTGAGAAAGGC AGG (reversed) Intergenic
No off target data available for this crispr