ID: 1061887365

View in Genome Browser
Species Human (GRCh38)
Location 9:133598588-133598610
Sequence GCTGCTGGTGGGAGAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061887356_1061887365 -6 Left 1061887356 9:133598571-133598593 CCAGGAGCCAGGCACCCGCTGCT No data
Right 1061887365 9:133598588-133598610 GCTGCTGGTGGGAGAGAGGGAGG No data
1061887350_1061887365 26 Left 1061887350 9:133598539-133598561 CCCAACAGTTGGGGCACTTAGAT No data
Right 1061887365 9:133598588-133598610 GCTGCTGGTGGGAGAGAGGGAGG No data
1061887355_1061887365 -5 Left 1061887355 9:133598570-133598592 CCCAGGAGCCAGGCACCCGCTGC No data
Right 1061887365 9:133598588-133598610 GCTGCTGGTGGGAGAGAGGGAGG No data
1061887351_1061887365 25 Left 1061887351 9:133598540-133598562 CCAACAGTTGGGGCACTTAGATA No data
Right 1061887365 9:133598588-133598610 GCTGCTGGTGGGAGAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061887365 Original CRISPR GCTGCTGGTGGGAGAGAGGG AGG Intergenic
No off target data available for this crispr