ID: 1061889385

View in Genome Browser
Species Human (GRCh38)
Location 9:133609540-133609562
Sequence GCCTGGGGGTGCCCCCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061889371_1061889385 29 Left 1061889371 9:133609488-133609510 CCTGGTGCTGACGGCTCGTCCGC No data
Right 1061889385 9:133609540-133609562 GCCTGGGGGTGCCCCCACCCTGG No data
1061889370_1061889385 30 Left 1061889370 9:133609487-133609509 CCCTGGTGCTGACGGCTCGTCCG No data
Right 1061889385 9:133609540-133609562 GCCTGGGGGTGCCCCCACCCTGG No data
1061889376_1061889385 1 Left 1061889376 9:133609516-133609538 CCCGGGACGCGCGACCTCCTGGA No data
Right 1061889385 9:133609540-133609562 GCCTGGGGGTGCCCCCACCCTGG No data
1061889377_1061889385 0 Left 1061889377 9:133609517-133609539 CCGGGACGCGCGACCTCCTGGAG No data
Right 1061889385 9:133609540-133609562 GCCTGGGGGTGCCCCCACCCTGG No data
1061889374_1061889385 10 Left 1061889374 9:133609507-133609529 CCGCTCTCGCCCGGGACGCGCGA No data
Right 1061889385 9:133609540-133609562 GCCTGGGGGTGCCCCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061889385 Original CRISPR GCCTGGGGGTGCCCCCACCC TGG Intergenic
No off target data available for this crispr