ID: 1061891763

View in Genome Browser
Species Human (GRCh38)
Location 9:133625406-133625428
Sequence GCCCTGCAGAATCACAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061891763_1061891766 3 Left 1061891763 9:133625406-133625428 CCATCCCTGTGATTCTGCAGGGC No data
Right 1061891766 9:133625432-133625454 GCCCCCACAGCTGCTTTCACAGG 0: 16
1: 43
2: 121
3: 398
4: 1076
1061891763_1061891771 7 Left 1061891763 9:133625406-133625428 CCATCCCTGTGATTCTGCAGGGC No data
Right 1061891771 9:133625436-133625458 CCACAGCTGCTTTCACAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061891763 Original CRISPR GCCCTGCAGAATCACAGGGA TGG (reversed) Intergenic
No off target data available for this crispr