ID: 1061892848

View in Genome Browser
Species Human (GRCh38)
Location 9:133631854-133631876
Sequence CCCTGTGTATGGAGGAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061892841_1061892848 -8 Left 1061892841 9:133631839-133631861 CCCCATCTCGCTGACCCCTGTGT No data
Right 1061892848 9:133631854-133631876 CCCTGTGTATGGAGGAGAGATGG No data
1061892843_1061892848 -10 Left 1061892843 9:133631841-133631863 CCATCTCGCTGACCCCTGTGTAT No data
Right 1061892848 9:133631854-133631876 CCCTGTGTATGGAGGAGAGATGG No data
1061892838_1061892848 16 Left 1061892838 9:133631815-133631837 CCACGCAGGTGTGAGAGTCCACC No data
Right 1061892848 9:133631854-133631876 CCCTGTGTATGGAGGAGAGATGG No data
1061892842_1061892848 -9 Left 1061892842 9:133631840-133631862 CCCATCTCGCTGACCCCTGTGTA No data
Right 1061892848 9:133631854-133631876 CCCTGTGTATGGAGGAGAGATGG No data
1061892840_1061892848 -5 Left 1061892840 9:133631836-133631858 CCTCCCCATCTCGCTGACCCCTG No data
Right 1061892848 9:133631854-133631876 CCCTGTGTATGGAGGAGAGATGG No data
1061892839_1061892848 -2 Left 1061892839 9:133631833-133631855 CCACCTCCCCATCTCGCTGACCC No data
Right 1061892848 9:133631854-133631876 CCCTGTGTATGGAGGAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061892848 Original CRISPR CCCTGTGTATGGAGGAGAGA TGG Intergenic
No off target data available for this crispr