ID: 1061895116

View in Genome Browser
Species Human (GRCh38)
Location 9:133643138-133643160
Sequence ATGCATATGGGGCTGTGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061895116_1061895124 7 Left 1061895116 9:133643138-133643160 CCCGGCCACAGCCCCATATGCAT 0: 1
1: 0
2: 0
3: 13
4: 192
Right 1061895124 9:133643168-133643190 GCTGCGTCCTGTCCCTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061895116 Original CRISPR ATGCATATGGGGCTGTGGCC GGG (reversed) Intronic
902500123 1:16905161-16905183 AGGCGTATGGAGCTGTGGCGGGG + Intronic
902618045 1:17634630-17634652 CTGGATATGGGGCTGGGGCCTGG + Intronic
903682135 1:25104202-25104224 ATGGAGATGGGGCTGAGGCGTGG - Intergenic
903708444 1:25303981-25304003 GTGCATATGTGGCTGCTGCCGGG + Intronic
903718670 1:25388432-25388454 GTGCATATGTGGCTGCTGCCGGG - Intronic
903858642 1:26352142-26352164 CTGCATGTGGGCCTGTGGACTGG - Intronic
904449245 1:30600499-30600521 CTCCATGTGGGGCTGTGGACGGG - Intergenic
905240691 1:36579151-36579173 ATGCATGTGGATCTGTGCCCAGG - Intergenic
905650690 1:39654722-39654744 ATGCATAGGTGGATGTGACCTGG + Intergenic
905916452 1:41687957-41687979 ATTCATCTGGAGCTGTGGCTGGG - Intronic
908526376 1:64992083-64992105 ATTCATATGTGATTGTGGCCAGG + Intergenic
913303454 1:117398334-117398356 ATGCATATGGGGCTATTGATGGG + Intronic
913593902 1:120354947-120354969 AGGCGTATGGAGCTGTGGCAGGG + Intergenic
913653796 1:120942554-120942576 AGGCATATGAGGCTGCGGCGGGG + Intergenic
914004487 1:143720662-143720684 AGGCATATGGAGCTGTGGCAGGG - Intergenic
914093354 1:144524039-144524061 AGGCGTATGGAGCTGTGGCAGGG - Intergenic
914096229 1:144546557-144546579 AGGCGTATGGAGCTGTGGCGGGG - Intergenic
914198720 1:145465798-145465820 AGGTATATGGGGCTGTGACAGGG - Intergenic
914302292 1:146387406-146387428 AGGCGTATGGAGCTGTGGCGGGG + Intergenic
914305175 1:146409863-146409885 AGGCGTATGGAGCTGTGGCAGGG + Intergenic
914377431 1:147084774-147084796 AGGCGTATGAGGCTGTGGCGGGG - Intergenic
914502930 1:148263436-148263458 AGGCGTATGGAGCTGTGGCGGGG + Intergenic
914514488 1:148362551-148362573 AGGCGTATGGAGCTGTGGCAGGG - Intergenic
914596883 1:149162962-149162984 AGGCGTATGGAGCTGTGGCAGGG - Intergenic
918389888 1:184048081-184048103 ATGTGTATGGGTCTGTTGCCTGG + Intergenic
923135889 1:231118344-231118366 TTGCAGATGCTGCTGTGGCCAGG - Intergenic
923483316 1:234404972-234404994 CTTCATATGGGGCTGGGGCGAGG - Intronic
924707524 1:246511717-246511739 GTGCATAGGAGGCTGTGGCTGGG + Intergenic
1062997691 10:1882166-1882188 AGGCATAGGGGGCTGTGGGTAGG + Intergenic
1063040901 10:2336411-2336433 AAGCCCTTGGGGCTGTGGCCTGG - Intergenic
1066044708 10:31584867-31584889 CTGCTCATGGGGCTGTGGCCAGG + Intergenic
1067474274 10:46556081-46556103 AGGCAAATGGGGCTGTGGGCCGG + Intergenic
1071265785 10:83963589-83963611 AGGCATATGGGCCTGTCTCCAGG - Intergenic
1073288102 10:102400383-102400405 ATGCATCTGGCGCTGCGGGCAGG + Exonic
1075392460 10:122102245-122102267 ATGGATATGCGGGTGTAGCCTGG + Intronic
1076292928 10:129361523-129361545 AGGCAGGTGGGGCTGTGTCCAGG - Intergenic
1078002313 11:7507050-7507072 ATGCATATAGGGTAGTGTCCTGG + Intronic
1078451446 11:11443728-11443750 ATCCATGTGGGGCCTTGGCCAGG - Intronic
1078858190 11:15223704-15223726 ATGGATATAGGGAGGTGGCCTGG + Intronic
1079914210 11:26348402-26348424 ATGCTTATGGAGTTCTGGCCTGG + Intronic
1080738268 11:35038804-35038826 ATGCTGATGGGGCTATGGCTAGG - Intergenic
1081872523 11:46389999-46390021 GTGCCTAGGGTGCTGTGGCCGGG + Intergenic
1083366920 11:62146969-62146991 ATGCAGGTGGGGCTGTGTCCAGG - Intronic
1085319909 11:75567715-75567737 AGGCATCTGGGCCTGAGGCCTGG - Intronic
1089096895 11:115927021-115927043 ATGCATATGCCTCTGTGGACAGG + Intergenic
1090699674 11:129282309-129282331 ATGCAGCTGGCGCTTTGGCCAGG - Intergenic
1090747773 11:129721003-129721025 CTGAATATGGGGAGGTGGCCAGG + Intergenic
1091638033 12:2213082-2213104 ATGCCTCTGGGGCTGGGGCCCGG + Intronic
1092241074 12:6836986-6837008 ATGCAGCTGGGGCTGGAGCCAGG + Exonic
1094572999 12:31658451-31658473 CTGCATCTGGGGCTGTTGACTGG + Intronic
1096614198 12:52822513-52822535 ATGTGTATAGGGCTGTGCCCAGG + Intronic
1102503525 12:113369242-113369264 ATGCTTGTGGGGCTGGGGCAGGG - Intronic
1104205658 12:126635649-126635671 CTGCTTATGTTGCTGTGGCCAGG + Intergenic
1104360841 12:128131796-128131818 ATGCATATGGGGGTGCTGGCAGG - Intergenic
1106722100 13:32445700-32445722 AGGCATTTGGGCCTGAGGCCAGG + Intronic
1107892591 13:44927325-44927347 ATGGAGATGGGGCTGTTTCCTGG + Intergenic
1113914478 13:113862563-113862585 ACGCACCTGGGGCTGTTGCCCGG - Intronic
1117199488 14:53373671-53373693 ATCCAAATGAGACTGTGGCCAGG + Intergenic
1118325112 14:64775170-64775192 ATGCAGACGAGGCTGAGGCCTGG - Exonic
1120480379 14:85041821-85041843 ATGCACATGGGTCTGGGTCCAGG - Intergenic
1121280188 14:92692355-92692377 ATGCATGATGGCCTGTGGCCAGG - Intergenic
1122009711 14:98735965-98735987 AGGCAGATGTGGATGTGGCCAGG + Intergenic
1126435848 15:48636724-48636746 ATGCATCTGGTTCTGTGACCAGG - Intronic
1134084557 16:11347375-11347397 AGGCAGATAGGGCTGTGGTCTGG + Intronic
1134339142 16:13329111-13329133 ATGCAAATGGGGCCTTTGCCTGG - Intergenic
1135045764 16:19153852-19153874 ATGCTCATGGGGCAGTGCCCTGG - Intronic
1135097210 16:19574446-19574468 CTACAAATGGGGCTGTGCCCTGG + Intronic
1135304639 16:21357493-21357515 ATGCATTTGTGGCTGTGTTCTGG + Intergenic
1135797754 16:25461711-25461733 ATGCTTATGGGTCTATGGCGTGG + Intergenic
1136301382 16:29336620-29336642 ATGCATTTGTGGCTGTGTTCTGG + Intergenic
1136625931 16:31462282-31462304 CAGCATCTGGGGCAGTGGCCAGG - Exonic
1136655469 16:31706677-31706699 CTGCATAGGGGCCTGTAGCCTGG + Intergenic
1138218551 16:55227447-55227469 ATCCACATGGGGCTGGGGCCAGG - Intergenic
1139656185 16:68388423-68388445 ATGCTTGTGAGCCTGTGGCCTGG - Intronic
1139931625 16:70531565-70531587 ATGCATAAGGGGCTGGGCCTGGG - Intronic
1142063079 16:88043317-88043339 ATGCATTTGTGGCTGTGTTCTGG + Intronic
1142795707 17:2304963-2304985 AAGCCTATGGGGCTGTGGAGGGG - Intronic
1143100904 17:4504188-4504210 GTGCAGATGTGGCAGTGGCCAGG - Intronic
1144809951 17:17992648-17992670 GTGCTGATGGTGCTGTGGCCAGG + Intronic
1145116046 17:20211456-20211478 CTGCTCAAGGGGCTGTGGCCTGG + Intronic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1148792670 17:50182298-50182320 GGGCAGATGGGGATGTGGCCTGG + Intergenic
1151697103 17:75723326-75723348 CTGCCTGAGGGGCTGTGGCCAGG + Intronic
1151712290 17:75813671-75813693 ATGCCTATGAGGCTGGGTCCAGG + Intronic
1152690064 17:81713895-81713917 CAGCATATGGCGCTGTGGTCAGG + Intronic
1154171799 18:12057567-12057589 ATGCCTGGAGGGCTGTGGCCCGG - Intergenic
1155087225 18:22470528-22470550 ATGGAGATGGGGCTGAGGCTGGG + Intergenic
1157512829 18:48290762-48290784 ATGCTTAGGTGGCTGTAGCCAGG + Intronic
1160112143 18:76043303-76043325 ATCCTTATGGGGGTGTGGCTTGG + Intergenic
1160865339 19:1253614-1253636 AGGCCTAGGGGGCTGTGGCAAGG - Intronic
1164432613 19:28201254-28201276 TTGCATATGGGGCTGAGGAGGGG + Intergenic
1165365352 19:35361902-35361924 ATGCATCTGGGGCTGCCGCTTGG + Intergenic
1165830923 19:38729811-38729833 AGGCACATGGGGCTTTGGCCTGG - Exonic
1166300948 19:41911974-41911996 GTGCATTTGGGGCTGTGGGGGGG - Intronic
925463169 2:4082706-4082728 AAGCACATGGGGGTGTGGGCTGG - Intergenic
926470009 2:13243140-13243162 GGGCATTTGGGGCTGTGGCGAGG + Intergenic
927809938 2:26175250-26175272 AGGCAGAAGGGGCTGTGTCCGGG - Intronic
929093293 2:38240587-38240609 ATGCAGAAGGGGCTGTGAGCAGG + Intergenic
930095232 2:47561520-47561542 ATGCACAGGGTGGTGTGGCCGGG + Intronic
931829739 2:66038419-66038441 ATGAATAGGAGTCTGTGGCCAGG - Intergenic
932428949 2:71661982-71662004 ATGCTGATGGGGCAGTGGGCAGG + Intronic
932894928 2:75630494-75630516 AATCATATGGGGCTGGGGCACGG + Intergenic
932983017 2:76693117-76693139 ATGCGTCTGGGCCTGCGGCCTGG - Intergenic
938932667 2:136100480-136100502 ATGGAGATGTGGGTGTGGCCCGG + Intergenic
945954297 2:216071250-216071272 AGGCTTTTGTGGCTGTGGCCAGG + Intronic
947794033 2:232883229-232883251 ATGCCTATGGGCCTGTCCCCAGG - Intronic
947953348 2:234166571-234166593 ATTCAGCTGGGGCTGTGGGCTGG + Intergenic
1170252781 20:14303762-14303784 ATGCATTGGGGGCTGTGGGTTGG - Intronic
1171263133 20:23750206-23750228 AGCCATAAGGGGCTGTGCCCAGG + Intronic
1171401811 20:24878302-24878324 AAAAAAATGGGGCTGTGGCCAGG - Intergenic
1171973891 20:31581625-31581647 GTGCAAATGGGGCTGGGGGCTGG - Intergenic
1172314573 20:33943803-33943825 TTGCATATTGAGGTGTGGCCAGG - Intergenic
1172323559 20:34016897-34016919 ATCAATATGGGCCTGTAGCCAGG + Intronic
1172480020 20:35265812-35265834 AGCCATATGTGGCTGTGGCTAGG + Intronic
1172647122 20:36477536-36477558 CTCCATAGGGGGCAGTGGCCAGG - Intronic
1172953784 20:38740400-38740422 AGGCATATGGGGTGCTGGCCAGG - Intergenic
1173268148 20:41505796-41505818 ATGTATATGAGGCTATTGCCAGG - Intronic
1175399077 20:58689788-58689810 ACGCATATGTGTGTGTGGCCAGG - Intronic
1175479220 20:59300021-59300043 CTGCGTGTGGGGCAGTGGCCTGG - Intergenic
1175675775 20:60945610-60945632 AGGCCAATGGGGCAGTGGCCTGG - Intergenic
1178478195 21:32956146-32956168 ATGCGTCTGGGGCTGAAGCCAGG + Intergenic
1180122820 21:45765291-45765313 ATGCAGATGGTGCTGTGGGAAGG - Intronic
1181688495 22:24545069-24545091 GGGCAGATGGGGCTGTGGGCAGG + Intronic
1183349961 22:37329556-37329578 ATGGAGATGGGGCTGGGGCAGGG + Intergenic
1183987851 22:41579098-41579120 CTGCCAATGGGGCTGTGGGCTGG + Intronic
1184364315 22:44040029-44040051 TTGCCTCTGGGGCTGTGGGCAGG + Intronic
1184554523 22:45225925-45225947 AGGCAGGTGGGGCTTTGGCCTGG - Intronic
1184857985 22:47156895-47156917 AAGACCATGGGGCTGTGGCCAGG - Intronic
1185417322 22:50717358-50717380 AGGCATATGGGTGTGTGACCTGG + Intergenic
949203449 3:1409216-1409238 ATGCATTTGTGACTGAGGCCAGG + Intergenic
950054018 3:10011234-10011256 ATGGATACGGGGGTGGGGCCAGG - Intergenic
950265440 3:11569601-11569623 CTGGAGATGGGGCTGTGTCCCGG - Intronic
952210776 3:31227102-31227124 ACACATATGGGGCTGGGCCCAGG + Intergenic
952213338 3:31251460-31251482 GAGCATATGGGGCTGTTGCTTGG - Intergenic
952643814 3:35631413-35631435 ATCCATATGGGTCTGAGGCCTGG - Intergenic
952966394 3:38623618-38623640 GTGCATACGGGGCTGAGGCCGGG - Intronic
953448354 3:42986611-42986633 CTGGAGATGGGGCTGGGGCCAGG + Intronic
954573584 3:51662561-51662583 ATGCAGATGTGGCTGCTGCCCGG + Exonic
956421837 3:69093970-69093992 AGGCATATGGAGCTGTGCTCTGG + Intronic
957910687 3:86617510-86617532 ATGCAAATGGGGCTTTTACCTGG - Intergenic
959568118 3:107853409-107853431 ATGCAAATGGGGCTGGGGTAGGG - Intergenic
960436042 3:117628074-117628096 ATGCATATGGGGAGGGGGCATGG - Intergenic
962840206 3:139225977-139225999 AGGGATCTGGGGCTGAGGCCAGG + Intronic
962988787 3:140559911-140559933 ATGCATGTTGGCCTGTGACCAGG - Intronic
963671823 3:148260352-148260374 CTGGAAGTGGGGCTGTGGCCTGG + Intergenic
967849305 3:194070515-194070537 ATGCCTTTGGGGCTGGGGCTCGG + Intergenic
967920231 3:194609034-194609056 ATGGGCATGGGGGTGTGGCCAGG + Intronic
968913326 4:3486534-3486556 GGGCATTGGGGGCTGTGGCCAGG - Intronic
974075681 4:57166242-57166264 ATGCATATGGGGTTGGGGTTGGG + Intergenic
975318712 4:72984792-72984814 ATGCATATGGCAATGTGGCAAGG + Intergenic
979099864 4:116600002-116600024 AGGCACATGGGGCTTTGGCCTGG - Intergenic
980433103 4:132729129-132729151 GAATATATGGGGCTGTGGCCAGG - Intergenic
985706943 5:1406817-1406839 AAGCAGATGGTGCTGGGGCCTGG - Intronic
985950570 5:3219048-3219070 ATGCAGCTTGGGCTGTGGCATGG + Intergenic
986244789 5:5997582-5997604 ATGCATGTGTGCCTGTGGCAGGG + Intergenic
987454767 5:18129772-18129794 ATGGATCTGGGGCTTTGGCAGGG + Intergenic
988476132 5:31587707-31587729 ATGCAAATGGCGCAATGGCCTGG - Intergenic
989147635 5:38264532-38264554 ATGGCTAAGGGGCAGTGGCCAGG + Intronic
993040953 5:82814213-82814235 ACGCAAATGGTTCTGTGGCCTGG - Intergenic
993041006 5:82814690-82814712 ATGCAAATGGTTCTGTGGCCTGG + Intergenic
997677230 5:135721841-135721863 ATCCTTCTTGGGCTGTGGCCAGG - Intergenic
1001837178 5:174842361-174842383 ATGTTTGTGGGGCAGTGGCCAGG + Intergenic
1002614009 5:180439192-180439214 ATGGAGATGGGGCTGGGGCCAGG - Intergenic
1004767054 6:18741530-18741552 AGGCATCTGGCTCTGTGGCCTGG - Intergenic
1005426323 6:25706503-25706525 ATGCATTTGGAGTGGTGGCCCGG - Intergenic
1006113675 6:31763786-31763808 ATGGAGATGAGGGTGTGGCCTGG + Intronic
1007420883 6:41718929-41718951 ATTAGTATGGGTCTGTGGCCTGG - Intronic
1007599270 6:43071712-43071734 ATGCATCTGGGGCTGGTGCTGGG - Intronic
1007643515 6:43362884-43362906 ATGCCAATGGTCCTGTGGCCTGG + Intronic
1011089688 6:83583193-83583215 ATGTATATGGGGATGTGGGTGGG - Intronic
1015100389 6:129471563-129471585 TTTCATATGGGGCTGTTGACTGG - Intronic
1017817536 6:158026631-158026653 ATGCACCTGGGACTGTTGCCAGG + Intronic
1018416483 6:163606372-163606394 CTCCATATGGTGCTGGGGCCAGG - Intergenic
1018790279 6:167143124-167143146 ATGCATGAGAGGCCGTGGCCAGG + Intergenic
1019274413 7:168339-168361 ATGCCCATGGGACTCTGGCCAGG - Intergenic
1019525087 7:1477216-1477238 AAGGGAATGGGGCTGTGGCCAGG - Intronic
1020049691 7:5073167-5073189 ATGCATCTGGGGGTGGGGTCTGG - Exonic
1020083897 7:5300368-5300390 AGGCGAGTGGGGCTGTGGCCGGG + Intronic
1021895403 7:25230311-25230333 ATTAATATGGGGCTTGGGCCAGG + Intergenic
1023237241 7:38102428-38102450 ATCCATCAGCGGCTGTGGCCAGG + Intergenic
1024752103 7:52478533-52478555 ATGCAAATGAGGTTGTTGCCTGG + Intergenic
1026210055 7:68296088-68296110 ATACATATTGGGCTGTGATCTGG - Intergenic
1026890553 7:73979273-73979295 ACGCAGATGAGGCTGGGGCCTGG - Intergenic
1027337317 7:77165477-77165499 AAGCAAATAGGCCTGTGGCCTGG + Intronic
1029778480 7:102705643-102705665 AAGCAAATAGGCCTGTGGCCTGG - Intergenic
1032403940 7:131642472-131642494 AGGCATGTGGCTCTGTGGCCTGG - Intergenic
1035394801 7:158527760-158527782 GTGTACATGGGGCTGGGGCCAGG + Intronic
1035777942 8:2203777-2203799 AAGGAGAGGGGGCTGTGGCCGGG + Intergenic
1039269600 8:35866474-35866496 AAGCTTATGGGGCAGTGGCATGG + Intergenic
1041439155 8:57875066-57875088 GTGCTGATGGGGCTGTGGACAGG - Intergenic
1041481952 8:58331902-58331924 ATGGAAATGGGGCTGGAGCCAGG + Intergenic
1048965942 8:139614539-139614561 GTGCTTAAGGGGCTGTTGCCAGG + Intronic
1051867055 9:21695142-21695164 ATGCCTCTGGGGCTGTAGACTGG + Intergenic
1057719404 9:97519900-97519922 AAGCAGATGAGGCTGTAGCCTGG - Intronic
1059212447 9:112526435-112526457 GTGGAGATGGGGCTTTGGCCAGG + Intronic
1059250483 9:112883612-112883634 ATGAACATAGGGCTGTGGACTGG + Intronic
1061835199 9:133324051-133324073 ATGCAGCTGGGGAAGTGGCCAGG + Intergenic
1061895116 9:133643138-133643160 ATGCATATGGGGCTGTGGCCGGG - Intronic
1061980752 9:134102127-134102149 AGGCAAAGGGGGCTGTGGGCGGG + Intergenic
1062106976 9:134760801-134760823 ATGCATGTGGGGGTGTGTCAGGG - Intronic
1190260872 X:48796037-48796059 ATACTTATGGGGGTGAGGCCCGG - Intergenic
1193083154 X:77425211-77425233 ATAAAAATGGGGTTGTGGCCAGG - Intergenic
1195477583 X:105304092-105304114 ATGGTTATGTGGCTGTGGCTTGG - Intronic
1196946611 X:120833038-120833060 CTGGAAAGGGGGCTGTGGCCAGG - Intergenic
1198014942 X:132601003-132601025 ATGAATCTGGGGCTGTTGCTAGG + Intergenic
1199759909 X:150897877-150897899 ATGCCTATGCGGCTGGGCCCTGG + Intronic