ID: 1061895160

View in Genome Browser
Species Human (GRCh38)
Location 9:133643330-133643352
Sequence ATTCGGAAGCCCATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 581
Summary {0: 1, 1: 0, 2: 0, 3: 47, 4: 533}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061895155_1061895160 -6 Left 1061895155 9:133643313-133643335 CCATTTTACAGATGGGCATTCGG 0: 1
1: 0
2: 5
3: 63
4: 970
Right 1061895160 9:133643330-133643352 ATTCGGAAGCCCATGGAGGAGGG 0: 1
1: 0
2: 0
3: 47
4: 533
1061895153_1061895160 -2 Left 1061895153 9:133643309-133643331 CCTCCCATTTTACAGATGGGCAT 0: 1
1: 2
2: 22
3: 147
4: 615
Right 1061895160 9:133643330-133643352 ATTCGGAAGCCCATGGAGGAGGG 0: 1
1: 0
2: 0
3: 47
4: 533
1061895149_1061895160 19 Left 1061895149 9:133643288-133643310 CCTGAAATTGTCTGGATCATCCC 0: 1
1: 0
2: 1
3: 3
4: 97
Right 1061895160 9:133643330-133643352 ATTCGGAAGCCCATGGAGGAGGG 0: 1
1: 0
2: 0
3: 47
4: 533
1061895145_1061895160 30 Left 1061895145 9:133643277-133643299 CCAGAAGTGCCCCTGAAATTGTC 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1061895160 9:133643330-133643352 ATTCGGAAGCCCATGGAGGAGGG 0: 1
1: 0
2: 0
3: 47
4: 533
1061895154_1061895160 -5 Left 1061895154 9:133643312-133643334 CCCATTTTACAGATGGGCATTCG 0: 1
1: 0
2: 9
3: 64
4: 953
Right 1061895160 9:133643330-133643352 ATTCGGAAGCCCATGGAGGAGGG 0: 1
1: 0
2: 0
3: 47
4: 533
1061895148_1061895160 20 Left 1061895148 9:133643287-133643309 CCCTGAAATTGTCTGGATCATCC 0: 1
1: 0
2: 0
3: 11
4: 108
Right 1061895160 9:133643330-133643352 ATTCGGAAGCCCATGGAGGAGGG 0: 1
1: 0
2: 0
3: 47
4: 533
1061895152_1061895160 -1 Left 1061895152 9:133643308-133643330 CCCTCCCATTTTACAGATGGGCA 0: 1
1: 8
2: 72
3: 283
4: 895
Right 1061895160 9:133643330-133643352 ATTCGGAAGCCCATGGAGGAGGG 0: 1
1: 0
2: 0
3: 47
4: 533
1061895147_1061895160 21 Left 1061895147 9:133643286-133643308 CCCCTGAAATTGTCTGGATCATC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1061895160 9:133643330-133643352 ATTCGGAAGCCCATGGAGGAGGG 0: 1
1: 0
2: 0
3: 47
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061895160 Original CRISPR ATTCGGAAGCCCATGGAGGA GGG Intronic
900566623 1:3335368-3335390 ACATGGAAGCCCTTGGAGGATGG + Intronic
901523981 1:9807785-9807807 GTCAGGAAGCCCAGGGAGGAGGG - Intronic
902092947 1:13918064-13918086 ATTCTGTAGCCCATGGAACAGGG + Intergenic
903597862 1:24509902-24509924 ATTCTGCAGCCCATGGATCAAGG - Intronic
903881450 1:26512823-26512845 ATTCTGCAGCCCATGGATCAGGG + Intergenic
904008451 1:27376169-27376191 AGCGGGAAGCCCATGTAGGAAGG + Intergenic
904112896 1:28140558-28140580 ACTTGGAAGGCCATGGAGGGAGG + Intergenic
906433119 1:45772228-45772250 CTTGGGAAGCCCAAGGTGGATGG - Intergenic
906953777 1:50355570-50355592 ATTCTGCAGCCCATGGAGCAAGG + Intergenic
907113051 1:51944406-51944428 ATTCTGCAGCCCATGGATCAAGG + Intronic
907181480 1:52574052-52574074 CTTTGGAAGGCCAAGGAGGAAGG + Intergenic
907649288 1:56278998-56279020 ATTCTGCAGTCCATGGATGAAGG - Intergenic
908042777 1:60133004-60133026 ATTGGGAAGCCGAGGCAGGAGGG - Intergenic
908689571 1:66763057-66763079 ATTCTGCAGCCCATGGATCAAGG - Intronic
909322191 1:74303633-74303655 ATTCTGTAGCCCATGGACCAAGG + Intronic
909365726 1:74819477-74819499 ATTCTGCAGCCCATGGATCAAGG - Intergenic
910076473 1:83285639-83285661 ATTCTGCAGCCCATGGATCAAGG + Intergenic
910078373 1:83308142-83308164 ATTCTGTAGCCCATGGATCAAGG - Intergenic
910187659 1:84560996-84561018 ATTCTGCAGCCCATGGAACAAGG + Intronic
910200569 1:84694119-84694141 ATTCTGCAGCCCATGGATAAAGG + Intergenic
910231670 1:84993960-84993982 ATTCTGCAGCCCATGGATCAAGG - Intronic
912902434 1:113666826-113666848 ATTCTGTAGCCCATGGATCAAGG - Intronic
912954210 1:114142078-114142100 ATTCTGCAGCCCATGGATCAAGG + Intronic
913207214 1:116550826-116550848 ATTCTGCAGCCCATGGATCAAGG - Intronic
913944046 1:125140442-125140464 ATTTGGGAGCCCAAGGTGGATGG - Intergenic
914772698 1:150704500-150704522 CTTTGGAAGGCCATGGAGGGAGG + Intronic
914960363 1:152200625-152200647 ATTCTGCAGCCCATGGATCAAGG - Intergenic
915023798 1:152806792-152806814 TTTCTGAGCCCCATGGAGGAAGG - Intronic
915695202 1:157733873-157733895 ATTCTGCAGCCCATGGATCAAGG + Intergenic
916169576 1:161991317-161991339 ATTCTGAAGCCCATGGATTAAGG - Intronic
916669402 1:167000085-167000107 ATTCTGTAGCCCATGGATCAAGG + Intronic
916847148 1:168663257-168663279 ATGCGGCAGCCCATGGATGAAGG + Intergenic
916947963 1:169748315-169748337 ATTCTGTAGCCCATGGATCAAGG - Intronic
917112215 1:171559993-171560015 ATTCTGCAGCCCATGGATCAAGG + Intronic
917284472 1:173410019-173410041 ATTTGGAAGGCCAGGGTGGATGG + Intergenic
917353176 1:174099536-174099558 ATTCTGTAGCCCATGGATTAAGG - Intergenic
918130617 1:181624923-181624945 ATTCTGTAGCCCATGGATTAAGG - Intronic
918203040 1:182285106-182285128 AGACAGAAGCCCCTGGAGGAAGG + Intergenic
918694470 1:187527140-187527162 ATTCTGCAGCCCATGGATCAAGG + Intergenic
918817318 1:189205224-189205246 ATTTAGAAGACCATGGATGAGGG - Intergenic
919093679 1:193003787-193003809 ATTCTGTAGCCAATGGATGAAGG - Intergenic
919211228 1:194489675-194489697 ATTCTTCAGCCCATGGATGAAGG + Intergenic
920081344 1:203375616-203375638 ATTCTGAAGCCCATGGATTAAGG - Intergenic
920620010 1:207536031-207536053 ATTCTGCAGCCCATGGCTGAAGG + Intronic
920621792 1:207554586-207554608 ATTCTGCAGCCCATGGCTGAAGG + Intronic
920623417 1:207571681-207571703 ATTCTGCAGCCCATGGCTGAAGG + Intronic
921090961 1:211842294-211842316 ATTCTGCAGCCCATGGATCAAGG - Intergenic
921502818 1:215926849-215926871 CTTCGGAAGGCCAAGGAGGGTGG - Intronic
922588787 1:226756598-226756620 ATTCTGCAGCCCATGGATCAAGG + Intergenic
922624065 1:227019635-227019657 ATTCTGTAGCCCATGGATAAAGG - Intronic
922768496 1:228168843-228168865 ATGCTGAATCCCACGGAGGATGG - Intronic
922903054 1:229152816-229152838 ATTCTGCAGCCCATGGATCAAGG - Intergenic
923638285 1:235723493-235723515 ACCCAGAAGCCCAGGGAGGAAGG + Intronic
924354148 1:243152189-243152211 ATTCTGCAGCCCATGGATCAAGG + Intronic
924728760 1:246693036-246693058 CTTTGGAAGGCCAAGGAGGAAGG - Intergenic
1062865954 10:854440-854462 ATTCGGTAGCCTATGGATCAAGG - Intronic
1064950037 10:20838057-20838079 ATTCTGCAGCCCATGGATCAAGG + Intronic
1065439609 10:25737679-25737701 ATTCTGCAGCCCATGGACCAAGG + Intergenic
1065899648 10:30194344-30194366 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1066285403 10:33961225-33961247 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1066810620 10:39329055-39329077 ATTTGGATGCACATGGAGGCTGG - Intergenic
1066999069 10:42589227-42589249 ATTGGGGAGCCTGTGGAGGATGG - Exonic
1067658602 10:48216857-48216879 ATTGGGAAGTCCTGGGAGGAGGG - Intronic
1067685433 10:48463966-48463988 CTCTGGAAGCCCATGGAGCATGG + Intronic
1068940818 10:62679102-62679124 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1069082253 10:64100978-64101000 ATTGGGAGGCCAAGGGAGGAGGG - Intergenic
1069334910 10:67337013-67337035 ATTCTGTAGCCCATGGATCAAGG + Intronic
1069787564 10:70998457-70998479 TTTCTGAAGTCCCTGGAGGAGGG - Intergenic
1069947049 10:71994321-71994343 ATTCTGCAGCCCATGGATCAAGG - Intronic
1070489292 10:76961004-76961026 ATTCTGTAGCCCATGGATCAAGG + Intronic
1070632314 10:78095751-78095773 ATTAGGGAGTCCTTGGAGGATGG + Intergenic
1070944620 10:80379314-80379336 ATTCTGTAGCCCATGGATCAAGG - Intergenic
1071438959 10:85672832-85672854 ATTCTGCAGCCCATGGATCAAGG + Intronic
1071971257 10:90909737-90909759 ATTCTGTAGCCCATGGATCAAGG + Intergenic
1072184895 10:93027844-93027866 ATTCTGCAGCCCATGGATCAAGG + Intronic
1072708511 10:97699736-97699758 CTTTGGAAGCCCAAGGTGGAAGG - Intergenic
1072850439 10:98884887-98884909 ATTCTGAAGCCCATGGATCAAGG + Intronic
1073186621 10:101618911-101618933 AAGAGGAAGCCCATGGAGGAAGG + Intronic
1074011497 10:109486105-109486127 ATTTGGAAGGCCAAGGAGGGTGG - Intergenic
1075354644 10:121760210-121760232 ATTCTGAAGCCCATGGATCAAGG + Intronic
1075491414 10:122873551-122873573 ATTCCGCAGCCCATGGATCAAGG + Intronic
1076513530 10:131029609-131029631 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1077185102 11:1232252-1232274 ATTGGGGACCCCATGGAGGCAGG + Intronic
1078398845 11:11005657-11005679 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1078805279 11:14693779-14693801 ATTCTGCAGCCCATGGATCAAGG + Intronic
1078995795 11:16697730-16697752 ATTCTGTAGCCCATGGACCAAGG - Intronic
1079132836 11:17758588-17758610 ATTCTGAAGCCCATGGACCAAGG - Intronic
1079134007 11:17765907-17765929 ATCAGGAAGCCCATGGGTGATGG + Intronic
1079750846 11:24194844-24194866 CTTTGGAAGGCCAAGGAGGATGG + Intergenic
1079975546 11:27086640-27086662 ATTCTGCAGCCCAGGGAGCAAGG + Intronic
1080940102 11:36906847-36906869 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1082205451 11:49428253-49428275 ATTTGGCAGCCCATGGATTAAGG + Intergenic
1083126036 11:60566648-60566670 ATTCTGCAGCCAATGGAGCAAGG + Intergenic
1083765411 11:64839163-64839185 ATCCTGCAGGCCATGGAGGAGGG - Exonic
1084426634 11:69087606-69087628 ACTCGGCAGCCCCTGGTGGAAGG - Intronic
1085367087 11:75958846-75958868 ATTCTGTAGCCCATGGATGAAGG - Intronic
1085614867 11:77989644-77989666 ATTTGGAAGCCCAAGGAGGGTGG + Intronic
1085828620 11:79875215-79875237 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1086404440 11:86487932-86487954 CTTCGGAAGGCCAAGGTGGAAGG + Intronic
1086471476 11:87117958-87117980 ATTCTGCAGCCCATGGATCAAGG - Intronic
1086649646 11:89272267-89272289 ATTCAGCAGCCCATGGATTAAGG - Intronic
1086764736 11:90681333-90681355 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1087540646 11:99513856-99513878 ATTCTGTAGCCCATGGATCAAGG + Intronic
1087589511 11:100168692-100168714 ATTCTGCAGCCCTTGGATGAAGG + Intronic
1087644936 11:100797726-100797748 ATTCTGCAGCCCATGGATCAAGG + Intronic
1088266788 11:107995289-107995311 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1088577633 11:111287114-111287136 CTTTGGAAGGCCATGGTGGATGG - Intergenic
1088941507 11:114462941-114462963 ATTCAGATGCCCATGGACAAGGG + Intergenic
1090650154 11:128799315-128799337 ATTACCAAGCCCATTGAGGAAGG - Intronic
1090880030 11:130825203-130825225 ACTCCGAAGCCCTTGGGGGAAGG - Intergenic
1091026201 11:132143313-132143335 AATCAGAAACCCATGGAGTAAGG + Intronic
1092152268 12:6258145-6258167 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1092852417 12:12642035-12642057 ATTCTGATTCCCATGGAAGATGG + Exonic
1093378473 12:18460328-18460350 CTTTGGAAGGCCAAGGAGGACGG + Intronic
1093450863 12:19311975-19311997 ATTCTGCAGCCCATGGATCAAGG - Intronic
1094280857 12:28736297-28736319 ATTCTGAATCCCATGGATTAAGG + Intergenic
1094440036 12:30465040-30465062 ATTCTGTAGCCCATGGATCAAGG - Intergenic
1094465276 12:30747334-30747356 ATTCTGCAGCCCATGGATCAAGG + Intronic
1095081424 12:38004123-38004145 ATTTGGGAGCCCATTGAGGCCGG + Intergenic
1095233250 12:39767171-39767193 ATTCTGCAGCCCATGGATCAAGG - Intronic
1095881848 12:47145862-47145884 ATTCTGCAGCCCATGGATCAAGG + Intronic
1097206589 12:57327114-57327136 ATTCTGCAGCCCATGGATCAAGG + Intronic
1097788483 12:63787971-63787993 ATTCTGCAGCCCATGGATCAAGG - Intronic
1098075092 12:66721059-66721081 ATTCTGTAGCCCATGGATCAGGG - Intronic
1098206573 12:68116944-68116966 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1099131963 12:78844018-78844040 ATTCTGCAGCCCATGGATTAAGG + Intergenic
1099789580 12:87315276-87315298 ATTCTGTAGCCCATGGATCAAGG + Intergenic
1100723405 12:97383061-97383083 ATTCTGCAGCCCATGGATGAAGG - Intergenic
1100791053 12:98130470-98130492 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1101149258 12:101869518-101869540 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1101685215 12:107012577-107012599 ATTCTGCAGCCCATGGATCAAGG + Intronic
1102044156 12:109819339-109819361 ATGCACACGCCCATGGAGGAAGG - Intronic
1102274951 12:111574663-111574685 TTTGGGAAGCCAAGGGAGGAGGG - Intronic
1103048208 12:117756634-117756656 ATTCTGCAGCCCATGGATTAAGG + Intronic
1103150226 12:118631702-118631724 ATTCAGAAGGCCTTTGAGGAGGG - Intergenic
1105554943 13:21438151-21438173 ATTCTGCAGCCCATGGATCAAGG + Intronic
1105998501 13:25696033-25696055 ATTCTGCAGCCCATGGATCAAGG - Intronic
1106102005 13:26701893-26701915 ATACATAAGCCCATGAAGGAGGG - Intergenic
1106456498 13:29932067-29932089 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1106818087 13:33431850-33431872 ATTGTAAACCCCATGGAGGAAGG - Intergenic
1107159670 13:37211290-37211312 CTTTGGGAGGCCATGGAGGATGG + Intergenic
1107257975 13:38453562-38453584 ATTCTGTAGCCCATGGATCAAGG + Intergenic
1107287216 13:38807544-38807566 ATTCTGCAGCCCATGGATTAAGG - Intronic
1108331050 13:49384680-49384702 ATTCTGCAGCCCATGGATAAAGG - Intronic
1109077110 13:57850076-57850098 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1109126035 13:58518185-58518207 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1110411573 13:75209395-75209417 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1110447326 13:75600744-75600766 ATTCTGCAGCCCATGGATCAAGG + Intronic
1110766577 13:79286198-79286220 ATTCAGCAGCCCATGGATCAAGG + Intergenic
1111075300 13:83227959-83227981 TTTGGGAACCCCATGCAGGAAGG + Intergenic
1111617559 13:90680306-90680328 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1111960231 13:94802058-94802080 CTTTGGAAGGCCAAGGAGGAAGG + Intergenic
1113057304 13:106282680-106282702 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1113304231 13:109059333-109059355 ATTCAGCAGCCCATGGATCAAGG - Intronic
1113695120 13:112340321-112340343 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1114047097 14:18884732-18884754 ATTCTGAAGCCCATGGTTCAAGG - Intergenic
1114117117 14:19634677-19634699 ATTCTGAAGCCCATGGTTCAAGG + Intergenic
1114152355 14:20057626-20057648 ATTCTGCAGCCCATGGAGCAAGG - Intergenic
1114368683 14:22059884-22059906 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1114611660 14:24045963-24045985 ATTCTGCAGCCCATGGATCAGGG - Intergenic
1114625547 14:24126938-24126960 ATTCTGTAGCCCATGGATCAAGG - Intronic
1116687925 14:48066143-48066165 ATTCAGCAGCCCATGGATCAAGG - Intergenic
1117497056 14:56315687-56315709 CTTCGGGAGGCCAAGGAGGAAGG + Intergenic
1117935528 14:60901413-60901435 ATTCTAAAGCCCATGGATCAAGG + Intronic
1118116865 14:62787975-62787997 ATTCTGCAGCCCATGGATCAAGG + Intronic
1118125087 14:62892980-62893002 ATTCTGCAGCCCATGGATCAAGG + Intronic
1118201323 14:63676650-63676672 CTTTGGAAGGCCAAGGAGGATGG - Intergenic
1118253650 14:64185762-64185784 CTTTGGAAGCCCAAGGTGGACGG - Intronic
1118656017 14:67949773-67949795 ATTCTGCAGCCCATGGATCAAGG - Intronic
1118790048 14:69082646-69082668 AAACTGAAGCCCATGGAGGGGGG - Intronic
1119336458 14:73837489-73837511 ATTTGGGAGGCCAAGGAGGATGG - Intergenic
1119386396 14:74260295-74260317 ATCCGGAATCCCATGGGGGAGGG + Intronic
1119883217 14:78118416-78118438 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1122246503 14:100406940-100406962 ATTCTGAATCCCAAGAAGGAAGG - Intronic
1123682733 15:22774217-22774239 AAACGGAAGCCCAAAGAGGAGGG + Intronic
1123762703 15:23444987-23445009 AAACGGAAGCCCAAAGAGGAGGG + Intronic
1124036624 15:26059056-26059078 ATTCTGAAGCCCATAGGTGAAGG + Intergenic
1124334484 15:28846740-28846762 AAACGGAAGCCCAAAGAGGAGGG + Intergenic
1124901690 15:33829289-33829311 ATTCTGCAGCCCATGGATCAAGG + Intronic
1125465397 15:39946076-39946098 ATTCTGTAGCCCATGGATGAAGG + Intronic
1125870535 15:43097099-43097121 ATTCTGTAGCCCATGGATCAAGG - Intronic
1126971691 15:54120536-54120558 ATTCTGCAGCCCATGGATCAGGG + Intronic
1127307803 15:57725118-57725140 ATTCAGCAGCCCATGGATCAAGG + Intronic
1127888095 15:63221738-63221760 ATTCGTGAGCCCAGGGTGGAAGG - Intronic
1128189816 15:65681474-65681496 ATTCTGCAGCCCATGGATCAAGG - Intronic
1128478622 15:68018515-68018537 ATTATCAAGCCCATTGAGGAGGG + Intergenic
1128733290 15:70035062-70035084 ATGAGGAAGGCCATGGAGGAGGG - Intergenic
1128848855 15:70930199-70930221 ATTCTGCAGTCCATGGAGCAAGG - Intronic
1129346288 15:74921942-74921964 ATTTGGAAGGCCAAGGTGGAAGG + Intronic
1132420858 15:101666991-101667013 ATTCTGCAGCCCATGGATCAAGG - Intronic
1135326216 16:21527361-21527383 AATGGGCAGCCCATGGAGAATGG + Intergenic
1136945875 16:34650379-34650401 ATTTGGAAGACCAAGGTGGAAGG - Intergenic
1137234049 16:46598334-46598356 ATTCTGCAGCCCATGGATCAAGG - Intronic
1137416249 16:48283753-48283775 ATTCTGCAGCCCATGGATCAAGG + Intronic
1138518274 16:57551895-57551917 ATTCTGCAGCCCATGGATCAAGG - Intronic
1139972311 16:70783765-70783787 ATTCGGATGCCCAGGGGAGAAGG + Intronic
1140256296 16:73339151-73339173 ATTCTGAAGCCCAAGTTGGATGG - Intergenic
1140512777 16:75520033-75520055 CTTCGGAAGCCCAAGGCGGGTGG - Intergenic
1140549027 16:75843735-75843757 ATTCTGCAGCCCATGGATTAAGG - Intergenic
1140650353 16:77081409-77081431 ATTCTCCAGCCCATGAAGGAAGG - Intergenic
1140983429 16:80133980-80134002 ATTCTGAAATCCATAGAGGAGGG - Intergenic
1141776957 16:86130115-86130137 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1142039263 16:87882088-87882110 AATGGGCAGCCCATGGAGAATGG + Exonic
1143753379 17:9048180-9048202 ATTCTGCAGCCCATGGACCAAGG - Intronic
1144530710 17:16036130-16036152 ATTCTGAAGCCCATGGATCAAGG - Intronic
1144605494 17:16662016-16662038 ATTTGGGAGGCCATGGAGGTTGG - Intergenic
1144706938 17:17375233-17375255 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1144779151 17:17799243-17799265 ATGAGGGTGCCCATGGAGGAGGG + Intronic
1145713912 17:27001304-27001326 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1145806532 17:27737514-27737536 ATTCTGAAGCCCATGGTTCAAGG + Intergenic
1146042810 17:29472916-29472938 ATTCTGCAGCCCATGGATCAAGG - Intronic
1149228418 17:54503084-54503106 ATTTGGCAGCCCATGGATCAAGG + Intergenic
1150462394 17:65363489-65363511 CTTTGGAAGCCCAAGGAGGGAGG - Intergenic
1150468045 17:65411739-65411761 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1151845587 17:76652529-76652551 ATTCTGCAGCCCATGGAATAAGG - Intergenic
1151949118 17:77339352-77339374 ATTCTGCAGCCCATGGAGAAGGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153395305 18:4613420-4613442 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1153871845 18:9328747-9328769 ATTCTGAAGCCCATGGATCAAGG + Intergenic
1154220008 18:12444006-12444028 ATTCTGTAGCCCATGGATCAAGG - Intergenic
1154249319 18:12730128-12730150 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1154389606 18:13924956-13924978 CCTCGGAAGCCCCTGGAGGGCGG - Intergenic
1155101684 18:22616862-22616884 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1155281632 18:24246386-24246408 AATGGGAAGCCAGTGGAGGAGGG + Intronic
1155741344 18:29291758-29291780 ATTCTGTAGCCCATGGAACAAGG + Intergenic
1156444763 18:37227767-37227789 ATTCTGCAGCCCATGGATCAAGG + Intronic
1159487624 18:69085361-69085383 CTTCGGAAGGCCATGGTGGGCGG + Intergenic
1160035120 18:75293784-75293806 ATTCGGGAGGCCGTGGCGGACGG - Intergenic
1160791747 19:926554-926576 ATTCGGGAGCCCAGAGAGGAGGG + Intronic
1161984203 19:7644900-7644922 ATCCCCAAGCCAATGGAGGAGGG - Intronic
1164490120 19:28702868-28702890 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1164859916 19:31554846-31554868 ATATGGAAGCCCAAGGAAGAAGG + Intergenic
1165125225 19:33590497-33590519 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1165723245 19:38094491-38094513 TTTGGGAAGCCAAAGGAGGAGGG - Intronic
1168232677 19:55043156-55043178 ATTTGGGAGGCCATGGCGGAAGG + Intronic
1168573593 19:57490225-57490247 ATTCTGAAGACCATGTAGGTAGG - Intronic
1168574955 19:57501813-57501835 ATTCTGAAGACCATGTAGGTAGG - Intronic
1168652998 19:58105312-58105334 ATTCTGCAGCCCATGGACCAAGG + Intronic
926095156 2:10076607-10076629 ATCCGGAAGCCAAGGGAGGAAGG - Intronic
926493416 2:13554203-13554225 ATTCTGCAGCCCATGGATCAAGG - Intergenic
928557621 2:32444640-32444662 CTTCGGGAGGCCATGGAGGGAGG + Intronic
928631303 2:33195176-33195198 ATTCTGTAGCCCATGGATCAAGG + Intronic
928720152 2:34111346-34111368 ATTCTGCAGCCCATGGATCAAGG + Intergenic
928726661 2:34181785-34181807 ATTCTGCAGCCCATGGATCAAGG + Intergenic
928915960 2:36470735-36470757 ATTCTGCAGCCCATGGACCAAGG + Intronic
929125509 2:38519702-38519724 ATTCTGAATCCCCTGGAGTAGGG - Intergenic
929180906 2:39038030-39038052 ATTCTGCAGCCCATGGATCAAGG + Intronic
929538327 2:42799374-42799396 CTTCGGGAGGCCAGGGAGGAAGG + Intergenic
929757864 2:44782760-44782782 ATTTGGTAGCCCATGGATCAAGG + Intergenic
929939099 2:46317367-46317389 ATTCTGAAGCCCATGGATCAAGG - Intronic
930256112 2:49093838-49093860 ATTTGGAAGGCCAAGGTGGATGG - Intronic
930929031 2:56858707-56858729 ATTAGGAAGCCAAGGCAGGAGGG - Intergenic
930991737 2:57664240-57664262 ATTCTGCAGCCCATGGATCAAGG - Intergenic
931005271 2:57843529-57843551 ACTCTGAAGCCTGTGGAGGATGG - Intergenic
931895347 2:66722698-66722720 ATTCTGTAGCCCATGGATCAAGG + Intergenic
932116847 2:69058658-69058680 ATTCTGTAGCCCATGGATCAGGG + Intronic
932186031 2:69696689-69696711 ATTCTGTAGCCCATGGATCAAGG - Intronic
932900991 2:75699818-75699840 CTTCGGAAGGCCAAGGTGGAAGG - Intronic
933630289 2:84648314-84648336 ATTCTGTAGCCCATGGATCAAGG + Intronic
934232102 2:90193326-90193348 ATTTGGGAGGCCAAGGAGGATGG - Intergenic
934548378 2:95238523-95238545 ACTCTGAAGCCCATGGATCAAGG + Intronic
934625111 2:95841051-95841073 ATTCTGAAGCCCATGGATCAAGG + Intronic
934808454 2:97260219-97260241 ATTCTGAAGCCCATGGATCAAGG - Intronic
934829055 2:97496967-97496989 ATTCTGAAGCCCATGGATCAAGG + Intronic
935353786 2:102179097-102179119 AGCCAGAAGCCCATGGAGCAGGG + Exonic
935990358 2:108713558-108713580 ATTCTGCAGCCCATGGATCATGG - Intergenic
936768008 2:115877026-115877048 ATTTGGAAGGCCAAGGAGGGCGG - Intergenic
936782994 2:116055917-116055939 ATTGGCAATCCCATGTAGGAAGG - Intergenic
937264812 2:120608793-120608815 AGACGGAAGCCCTTGGAGCAGGG + Intergenic
937340455 2:121087591-121087613 ATCCCTAAGCCCAAGGAGGAGGG + Intergenic
939185848 2:138860106-138860128 ATTCTGTAGCCCATGGATTAAGG - Intergenic
939509225 2:143086186-143086208 ATTCTGCAGCCCATGGAACAAGG + Intergenic
939556109 2:143675538-143675560 ATTCTGCAGCCCATGGATCAAGG - Intronic
941727558 2:168879803-168879825 ATTCTGCAGCCCATGGATCAAGG - Intronic
941801785 2:169667592-169667614 ATTCTGCAGCCCATGGATCAAGG - Intronic
942050953 2:172140566-172140588 ATTCTGCAGCCCATGGATCAAGG + Intergenic
942540005 2:177006285-177006307 ATTCTGCAGCCCATGGACCAAGG + Intergenic
942999194 2:182303287-182303309 ATTCTGCAGCCCATGGATCAAGG - Intronic
943694989 2:190917659-190917681 ATTCTGCAGCCCATGGATCAAGG - Intronic
944255853 2:197623050-197623072 ATTCTGCAGCCCATGGATCAAGG + Intronic
944449173 2:199823500-199823522 ATTCTGCAGCCCATGGATCAAGG - Intronic
945126261 2:206514101-206514123 ATTCTGAAGCCCATGAATCAAGG + Intronic
945830123 2:214774393-214774415 ATTCTGTAGCCCATGGATCAAGG - Intronic
946747163 2:222857931-222857953 ATTCTGCAGCCCATGGATCAAGG + Intergenic
947035406 2:225848168-225848190 ATTCTGAAGCCCATGGATCAAGG - Intergenic
947754087 2:232548873-232548895 ATTCTGCAGCCCATGGATCAAGG - Exonic
948107236 2:235424662-235424684 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1169432830 20:5554703-5554725 ATTCTGCAGCCCATGGATCAAGG + Intronic
1171382361 20:24743280-24743302 ACTCTGAATCACATGGAGGATGG - Intergenic
1172450814 20:35021321-35021343 CCTCAGAAGCCCCTGGAGGAGGG + Exonic
1172483569 20:35285623-35285645 ATGGGGAAACCCCTGGAGGAGGG - Intergenic
1173471762 20:43329495-43329517 AGTCATGAGCCCATGGAGGAAGG + Intergenic
1173941986 20:46918891-46918913 ATTCTGCAGCCCATGGATCAAGG - Intronic
1174212368 20:48890112-48890134 CCCCTGAAGCCCATGGAGGAAGG - Intergenic
1174292346 20:49518026-49518048 TTTAGCAATCCCATGGAGGAGGG - Intronic
1174316419 20:49705934-49705956 CTTTGGAAGGCCAAGGAGGACGG + Intronic
1174652660 20:52141210-52141232 ATTCTGTAGCCCATGGATGAGGG + Intronic
1175025496 20:55897972-55897994 ATTCTGCAGCCCATGGATCAGGG - Intergenic
1175088278 20:56479686-56479708 ATTCTGCAGCCCATGGATCAAGG - Intronic
1175160626 20:57005185-57005207 ATCTGGAAGCCCTTTGAGGATGG - Intergenic
1175167882 20:57058521-57058543 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1175250482 20:57607016-57607038 ATTCTGCAGCCCATGGATTAAGG + Intronic
1175538706 20:59734498-59734520 CTTGGGAAGCCAATGCAGGAGGG - Intronic
1178284595 21:31315125-31315147 CTTTGGAAGGCCATGGCGGATGG + Intronic
1178894185 21:36545082-36545104 TTTCTGAAGCCCATGGAGAGAGG + Intronic
1179202872 21:39243022-39243044 ATTCTGCAGCCCATGGATCAAGG + Intronic
1179309630 21:40184341-40184363 GTTTGGAAGCCCTGGGAGGAAGG - Intronic
1180465631 22:15607383-15607405 ATTCTGAAGCCCATGGTTCAAGG - Intergenic
1181930545 22:26397280-26397302 ATTCTACAGCCCATGGATGAAGG - Intergenic
1182731265 22:32496745-32496767 ATTCTGAAGCTCATGGATCAAGG + Intronic
1182930180 22:34166104-34166126 ATTCTCAAGCTCATGGAGGAGGG + Intergenic
1183337792 22:37260589-37260611 AGCCGGAAGGCCATGGGGGAGGG - Intergenic
1183612457 22:38918956-38918978 ATTCTGCAGCCCATGGACCAAGG - Intergenic
1184447026 22:44554292-44554314 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1185084434 22:48731822-48731844 ATTCTGCAGCCCATGGATCAAGG + Intronic
1185086467 22:48743583-48743605 ATTCCTGAGCTCATGGAGGAGGG + Intronic
1185178144 22:49342545-49342567 ATTCTGCAGCCCATAGATGAAGG + Intergenic
950632558 3:14292973-14292995 ATTCTGCAGCCCATGGATCAAGG + Intergenic
950734873 3:14998766-14998788 CTTTGGAAGGCCAAGGAGGAAGG + Intronic
952119347 3:30223295-30223317 ATTCTGCAGCCCATGGATCAAGG - Intergenic
953211791 3:40881957-40881979 ATTCTGCAGCCCATGGATCAAGG - Intergenic
953646336 3:44759203-44759225 ATTCTGCAGCCCATGGATCAAGG - Intronic
954807605 3:53229541-53229563 ATTCAGAAGCCCAGAAAGGATGG - Intronic
955604224 3:60682718-60682740 ATTCTGCAGCCCATGGGTGAAGG + Intronic
955969887 3:64428118-64428140 ATTCTGCAGCCCATGGATCAAGG + Intronic
956180388 3:66512468-66512490 ATTCTGCAGCCCATGGATCAAGG - Intergenic
957067681 3:75539148-75539170 TTACGTAAGCCCATGGAGAAGGG - Intergenic
957469040 3:80634593-80634615 ATTCTGAAGCTCATGGATCAAGG - Intergenic
957707037 3:83802265-83802287 ATTCTGCAGCCCATGGATCAAGG - Intergenic
957863649 3:85993652-85993674 ATTCTGTAGCCCATGGATCAAGG - Intronic
958121563 3:89296351-89296373 ATTCTGAAGCCCATGAATCAAGG - Intronic
959030409 3:101293264-101293286 ATTCTGCAGCCCATGGAGTAAGG - Intronic
959109713 3:102107563-102107585 ATTCTGCAGCCCATGGATCAAGG - Intronic
959800033 3:110482481-110482503 ATTCTGTAGCCCATGGATCAGGG + Intergenic
960097896 3:113705505-113705527 ATTCTGCAGCCCATGGATCAAGG - Intergenic
960109807 3:113834690-113834712 CTTTGGAAGCCCAAGGAGGGTGG + Intronic
961411522 3:126725224-126725246 ATTCTGTAGCCCATGGATCAAGG - Intronic
962033603 3:131627478-131627500 ATTCTGCAGCCCATGGATCAAGG + Intronic
963293102 3:143513707-143513729 ATTCTGCAGCCCATGGATCAAGG - Intronic
964018995 3:151984260-151984282 ATTCTGAAGTCCATGGATCAAGG - Intergenic
966995691 3:185278000-185278022 ATTCTGCAGCCCATGGATCAAGG - Intronic
967325748 3:188237537-188237559 ATTCTGCAGCCCATGGATCAAGG - Intronic
967802806 3:193682872-193682894 ATTCTGCAGCCCATGGATCAAGG + Intronic
968153732 3:196360687-196360709 ATTCTGCAGCCCATGGATCAAGG + Intronic
968202692 3:196769081-196769103 ATTTGGGAGGCCAAGGAGGATGG + Intronic
968539607 4:1158059-1158081 ATTCTGCAGCCCATGGATCAAGG - Intergenic
969241706 4:5902998-5903020 ATGCAGAGGCCCAGGGAGGAAGG - Intronic
970629037 4:17921483-17921505 ATTCTGTAGCCCATGGATCAAGG - Intronic
970847444 4:20557639-20557661 ATTCTGCAGCCCATGGATAAAGG + Intronic
971441351 4:26690826-26690848 ATTCTGCAGCCCATGGATAAGGG + Intronic
972383573 4:38541988-38542010 ATTCTGCAGCCCATGGATCAAGG - Intergenic
973000796 4:44946865-44946887 ATTCAGCAGCCCATGGATCAAGG + Intergenic
973235211 4:47894970-47894992 ATTCTGCAGCCCATGGATCAAGG - Intronic
973849944 4:54951433-54951455 ATTCTGCAGCCCATGGATCAAGG - Intergenic
977416698 4:96742799-96742821 ATGCAGAAGCCCATGGCGTAAGG - Intergenic
977688205 4:99873515-99873537 ATTCTGCAGCCCATAGATGAGGG - Intergenic
978287112 4:107092511-107092533 ATTCTGAAGGCCATGGATCAAGG + Intronic
978523333 4:109639225-109639247 ATTTTGAAGCCCATGGATCAAGG - Intronic
978530288 4:109705437-109705459 ATTCTGAAGCCCAGGGATCAAGG + Intergenic
978610877 4:110537793-110537815 ATTCTGAAGCCCATGGATCAAGG - Intronic
979247652 4:118527439-118527461 ATTCTGCAGCCCATGGATCAAGG - Intergenic
979293373 4:119002734-119002756 CTTAGGAAGCAAATGGAGGAAGG - Intronic
979307849 4:119168304-119168326 ATTCTGTAGCCCATGGATCAAGG + Intronic
979448913 4:120845677-120845699 ATTCTGCAGCCCATGGATCAAGG + Intronic
979648709 4:123105434-123105456 ATTCTGCAGCCTATGGATGAAGG + Intronic
980262897 4:130477263-130477285 TTTCTGAAGCCCATGGACCAAGG + Intergenic
980858486 4:138469904-138469926 ATTCTGCAGCCCATGGATCAAGG + Intergenic
981078007 4:140609713-140609735 GTTAGGCAGGCCATGGAGGAGGG + Intergenic
981464326 4:145050167-145050189 ATTCTGCAGCCCATGGATCAAGG - Intronic
981898961 4:149839167-149839189 ATTCTGCAGCCCATGGATCAAGG - Intergenic
982169869 4:152650769-152650791 ATTCTGCAGCCCATGGATTAAGG - Intronic
982407252 4:155034226-155034248 ATTTGGGAGCCCAAGGTGGAAGG - Intergenic
982453587 4:155580888-155580910 ATTCTGCAGCCCATGGATCAAGG + Intergenic
982458955 4:155644107-155644129 ATTCTGCAGCCCATGGATCAAGG + Intergenic
982520569 4:156411622-156411644 ATTCTGCAGCCCATGGATCAAGG - Intergenic
983701886 4:170606987-170607009 ATTCTGTAGCCCATGGATCAAGG - Intergenic
983758272 4:171370034-171370056 ATTCTGAAGCCCACGGATAATGG + Intergenic
984299457 4:177896263-177896285 ATTCTGCAGCCCATGAATGAAGG + Intronic
985185495 4:187310614-187310636 ATTCTGCAGCCCATGGATCAAGG - Intergenic
985188146 4:187340408-187340430 ATTCTGTAGCCCATGGATCAAGG - Intergenic
985328477 4:188799035-188799057 ATTCTGCAGCCCATGGATCAAGG + Intergenic
985430337 4:189873301-189873323 ATTCTGAAGCTCAGGGATGAAGG + Intergenic
985940685 5:3133471-3133493 ATTCTTAAGCCCATGGAAGTCGG + Intergenic
986393339 5:7304753-7304775 AAACGGAAGCCCAAAGAGGAGGG + Intergenic
986703607 5:10435959-10435981 CTTTGGGAGCCCAAGGAGGACGG - Exonic
986752898 5:10805782-10805804 ATTCTGCAGCCCATGGATCAAGG + Intergenic
986987710 5:13517680-13517702 ACTCAGAAGCCCTTGGAGAAGGG - Intergenic
987544551 5:19296212-19296234 ATTCTAAAGCCCATGGATCAAGG + Intergenic
988036832 5:25837770-25837792 ATTCTGTAGCCCATGGATCAAGG - Intergenic
988782533 5:34535893-34535915 ATTTGGAAGACTATGGAGGAAGG - Intergenic
988866297 5:35338843-35338865 AGTCTGCACCCCATGGAGGAGGG - Intergenic
990481663 5:56217394-56217416 ATTCTGCAGCCCATGGATCAAGG + Intronic
990677209 5:58200880-58200902 ATTCTGCAGCCCATGGATCAAGG + Intergenic
991621945 5:68554014-68554036 ATTCTGCAGCCCATGGATCAAGG - Intergenic
991651303 5:68857348-68857370 ATTCAGTAGCCCATGGATCAAGG - Intergenic
992836083 5:80642864-80642886 ATTCTGCAGCCCATGGATCAAGG + Intronic
992922317 5:81538945-81538967 ATTCTGCAGCCCATGGATCATGG + Intronic
993393690 5:87355605-87355627 ATTCTGCAGCCCATGGATCAAGG + Intronic
993599735 5:89906791-89906813 ATTCTGCAGCCCATGGATCAAGG - Intergenic
993956211 5:94236048-94236070 ATTCTGTAGCCCATGGAACAAGG + Intronic
994253687 5:97567665-97567687 ATTCTGTAGCCCATGGATTAAGG + Intergenic
995001536 5:107136930-107136952 GTTCTGAAGCCTATGGATGAAGG - Intergenic
995668867 5:114577083-114577105 ATTCTGCAGCCCATGGATCAAGG - Intergenic
996464976 5:123789801-123789823 ATTCTGTAGCCCATGGATCAAGG + Intergenic
997151428 5:131500138-131500160 CTTTGGGAGGCCATGGAGGATGG - Intronic
997546497 5:134712491-134712513 CTTTGGGAGGCCATGGAGGACGG - Intronic
997669282 5:135657058-135657080 ATTCAGATGCCCATTGAGGAGGG - Intergenic
998357347 5:141551204-141551226 CTTTGGAAGGCCAAGGAGGAAGG + Intronic
998500614 5:142629405-142629427 ATTTGGAAGGCCAGGGTGGAAGG - Intronic
999040403 5:148403458-148403480 ATTAGGAAACCCAAGGAAGAAGG - Intronic
999524575 5:152390318-152390340 ATTCTGAAGCCCATAGATCAAGG - Intergenic
1000586630 5:163107783-163107805 ATTCTGCAGCCTATGGAGCAAGG - Intergenic
1001091480 5:168744872-168744894 ATTCTGCAGCCCATGGATCAAGG + Intronic
1001183352 5:169542022-169542044 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1001373212 5:171228055-171228077 ATTCTGCAGCCCATGGATCAAGG + Intronic
1002094472 5:176822976-176822998 ATCTGGCAGCCCATGGAGGATGG + Intronic
1002198567 5:177514185-177514207 ACTCAGAAGTCCGTGGAGGAAGG + Intronic
1002985190 6:2183126-2183148 ATTCTGCAGCCCATGGATCAAGG + Intronic
1003830856 6:10009724-10009746 ATTCTGTAGCCCATGGATCAAGG - Intronic
1004067970 6:12268162-12268184 ATTCTGTAGCCCATGGATCAAGG + Intergenic
1004658001 6:17683381-17683403 ATTCTGCAGCCCATGGATCAAGG - Intronic
1004834749 6:19517694-19517716 TTTCCATAGCCCATGGAGGAGGG - Intergenic
1005689969 6:28294854-28294876 ATTCTGTAGCCCATGGATCAAGG + Intronic
1006114321 6:31767199-31767221 TTTGGGATCCCCATGGAGGATGG - Exonic
1006693521 6:35911026-35911048 ATTCTGCAGCCCATGGATCAAGG + Intronic
1006936024 6:37718814-37718836 TTTGGGAAGCCGAGGGAGGAAGG + Intergenic
1006959498 6:37914082-37914104 ATTCTGTAGCCCATGGATCAAGG - Intronic
1007323355 6:41042654-41042676 ACTCAGAAGCACTTGGAGGAAGG + Exonic
1007651720 6:43426771-43426793 CTTCGGAAGGCCAAGGCGGACGG + Intergenic
1007884369 6:45209216-45209238 ATTCTGCAGCCCATGGATCAAGG + Intronic
1009240736 6:61183346-61183368 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1009525623 6:64741167-64741189 CTTCTGAAGCCCATGGATCAAGG - Intronic
1012836645 6:104277889-104277911 ATTCTGAAGCCCATGAATTAAGG - Intergenic
1012928499 6:105292313-105292335 ATTCTGCAGCCCATGGATCAAGG - Intronic
1012930865 6:105314899-105314921 ATTCTGCAGCCCATGGATGAAGG - Intronic
1013172772 6:107652076-107652098 ATTCTGCAGCCCATGGATCAAGG + Intronic
1014130431 6:117825451-117825473 ATTCTGCAGCTCATGGATGAAGG + Intergenic
1014319685 6:119911592-119911614 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1014521644 6:122450488-122450510 ATTCTGCAGCCCATGGAAAAAGG + Intronic
1014705116 6:124736861-124736883 ATTCTGCAGCCCATGGATCAAGG + Intronic
1014748738 6:125231203-125231225 ATTAGGAAGGCCATGCAGGAAGG - Intronic
1014856188 6:126404256-126404278 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1014885024 6:126769426-126769448 ATTAGAAAGCCCATGCATGATGG + Intergenic
1015485045 6:133760188-133760210 ATTGGGAATCACCTGGAGGATGG - Intergenic
1015613445 6:135050263-135050285 ATTCTGAAGCCTCTGGAGGCAGG - Intronic
1015640729 6:135328598-135328620 AATAGGAAGCCCAAGGAGAAGGG - Intronic
1015640802 6:135329635-135329657 ATTCTGCAGCCCATGGATCAAGG + Intronic
1015889000 6:137950538-137950560 ATTCTCAAAACCATGGAGGAGGG + Intergenic
1016220277 6:141660680-141660702 ATTCTGCAGCCCATGGATAAGGG - Intergenic
1016572314 6:145528713-145528735 ATTCTGGAGCCCATGGATCAAGG + Intronic
1016867484 6:148782025-148782047 ATTCTGCAGCCCATGGATCAAGG + Intronic
1016903356 6:149124233-149124255 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1017183938 6:151581751-151581773 ATTCTGCAGCCCATGGATCAAGG - Intronic
1017383479 6:153857007-153857029 ACTCGGGAGCCCATGGGGCAGGG + Intergenic
1017384875 6:153871999-153872021 ATTCTGTAGCCCATGGATCAAGG - Intergenic
1018076509 6:160220655-160220677 ATTCTGCAGCCCATGGATCAAGG - Intronic
1018818393 6:167353263-167353285 ATTCTGCAGCCCATGGATCAAGG + Intronic
1019678970 7:2334024-2334046 ACTCGGAAGGCCAAGGAGGGAGG + Intronic
1020091135 7:5341991-5342013 ATTCTGCAGCCCATAGATGAAGG + Intronic
1020596796 7:10216592-10216614 ATTAGGTAGCCCGTGGATGAAGG - Intergenic
1020626255 7:10583485-10583507 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1020664638 7:11024839-11024861 ATTCTGAAGCCCATGGATCAAGG + Intronic
1021856944 7:24866392-24866414 ATTTGGAAGGCCACGGAGGGAGG + Intronic
1021931530 7:25585826-25585848 ATTCAGACCCCCATGGGGGAAGG + Intergenic
1022326237 7:29334509-29334531 ATTTGGAAGCCCAAGGTGGGTGG + Intronic
1022326653 7:29338263-29338285 AATCTGAAGCCCACAGAGGATGG - Intronic
1022390322 7:29938272-29938294 TTTGGGAGGCCCATGGAGGGTGG - Intronic
1022690171 7:32642161-32642183 ATTCTGCAGCCCATGAAGCAAGG + Intergenic
1022917706 7:34976027-34976049 ATTCTGCAGCCCATGAAGCAAGG + Intronic
1023711588 7:42999051-42999073 ATTCTGTAGCCCATGGATCAAGG - Intergenic
1025017702 7:55452605-55452627 ATTCTGCAGCCCATGGATCAAGG - Intronic
1025988357 7:66475221-66475243 ATTTGGAAGGCCATGGTGGGTGG - Intergenic
1027294251 7:76750935-76750957 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1027296150 7:76773319-76773341 ATTCTGTAGCCCATGGATCAAGG - Intergenic
1027379174 7:77587258-77587280 ATTCTGCAGCCCATGGATCAAGG - Intronic
1027490375 7:78816855-78816877 ATTCTGTAGCCCATGGATCAAGG + Intronic
1027511993 7:79094648-79094670 ATTCTGTAGCCCATGGATCAAGG - Intronic
1028137356 7:87236159-87236181 ATTCTGCAGCCCATGGATTAAGG - Intergenic
1028352840 7:89870354-89870376 ATTCTGCAGCCCATGGATGAAGG - Intergenic
1028870608 7:95767715-95767737 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1029981206 7:104880818-104880840 ATTCTGCAGCCCATGGATCAAGG + Intronic
1030426069 7:109380183-109380205 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1030723091 7:112892818-112892840 ATTCTGCAGCCCATGGATCAAGG - Intronic
1031747031 7:125512453-125512475 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1031747080 7:125513183-125513205 ATTCTGTAGCCCATGGATCAAGG + Intergenic
1031860131 7:126969867-126969889 ATTCTGCAGCCCATGGATCAAGG - Intronic
1031878570 7:127169999-127170021 ATTCTGTAGCCCATGGATCAAGG + Intronic
1031983626 7:128147949-128147971 ATTCTGTAGCCGATGGAGAATGG + Intergenic
1032180802 7:129675534-129675556 ATTCTGCAGCCCATGGATCAAGG - Intronic
1033386402 7:140880678-140880700 ATTCTGCAGCCCATGGATCAAGG - Intronic
1034011937 7:147538406-147538428 CTTTGGAAGGCCAAGGAGGAAGG + Intronic
1034260558 7:149752804-149752826 ATGGGGAAGCCCAGGGAGGCCGG + Intergenic
1034404539 7:150894028-150894050 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1034582706 7:152059556-152059578 ATTCTGCAGCCCATGGATCAAGG - Intronic
1034946624 7:155266640-155266662 ATAGGGAAGCCCATGGATGCCGG - Intergenic
1035036144 7:155895856-155895878 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1035144497 7:156800611-156800633 ATTCTGTAGCCCATGGATCAAGG + Intronic
1035958863 8:4114505-4114527 ATTCTGCAGCCCATGGATCAAGG + Intronic
1036439463 8:8767605-8767627 CTTCCGAAGACCATGTAGGATGG + Intergenic
1038071342 8:24017564-24017586 ACTTGGAAGACCAAGGAGGATGG + Intergenic
1038164113 8:25068081-25068103 ATTCTTAGGCACATGGAGGAAGG - Intergenic
1038297536 8:26309209-26309231 ATTCTGTAGCCCATGGATCAAGG - Intronic
1038424689 8:27457421-27457443 ATTCTGCAGCCCATGGATCAAGG + Intronic
1039266817 8:35833982-35834004 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1039481263 8:37875085-37875107 TTTCTGAAGCCCTTGGGGGATGG + Exonic
1039580846 8:38665835-38665857 AATCAGAATCCCAGGGAGGAAGG - Intergenic
1040058172 8:43079637-43079659 ATTCTGCAGCCCATGGATAAAGG + Intronic
1040068249 8:43166706-43166728 ATTCTGCAGCCCATGGATCAAGG + Intronic
1040732324 8:50463426-50463448 ATTCTGAAGCCCATGGATCAAGG - Intronic
1041100007 8:54386828-54386850 ATTCGGTAGCCCATGGATCAAGG - Intergenic
1041586508 8:59526646-59526668 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1042099905 8:65264273-65264295 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1042402175 8:68362397-68362419 ATTCCAAAGGCCATGGAGGGAGG + Intronic
1042455464 8:68997250-68997272 TTTTGGAAGGCCATGGCGGATGG + Intergenic
1042730152 8:71924282-71924304 ATGGGGAAACCCATGGGGGAAGG + Intronic
1043351485 8:79366280-79366302 GTTGGGAAGCCCATGGAAGTAGG - Intergenic
1043774335 8:84246015-84246037 ATTCAGAAGCCAAAGGAAGATGG + Intronic
1044259479 8:90100939-90100961 ATTCTGTAGCCCATGGATGAAGG - Intergenic
1044287986 8:90431703-90431725 ATTCTGCAGCCCATGGATTAAGG + Intergenic
1044289383 8:90449678-90449700 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1044449457 8:92317210-92317232 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1045504861 8:102771262-102771284 ACTTGGAAGCACAGGGAGGAGGG - Intergenic
1045541751 8:103093088-103093110 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1045948288 8:107822576-107822598 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1047400733 8:124544744-124544766 ATTCTGCAGCCCATGGATCAAGG + Intronic
1047487928 8:125349503-125349525 ATTTGGAAGGCCAAGGTGGAAGG + Intronic
1048921520 8:139235557-139235579 CTGGGGAAGCCCATGGAGAAAGG + Intergenic
1049375329 8:142286737-142286759 ACTGGGAAGCCCGTGGAGGTGGG - Intronic
1049672347 8:143875570-143875592 ATTCAGAGGACCATGGAGTAGGG + Intronic
1050384705 9:5075731-5075753 ATTCTGTAGCCCATGGATCAAGG + Intronic
1050437177 9:5623397-5623419 ATTCTGTAGCCCATGGACCAAGG - Intergenic
1051207224 9:14700863-14700885 ATTGGCAGGCCCTTGGAGGAGGG + Intergenic
1051601616 9:18880407-18880429 ATTCTGCAGCCCATGGATCAAGG - Intronic
1051797679 9:20892242-20892264 ATTCTGCAGCCCATGGATCAAGG + Intronic
1051944978 9:22557388-22557410 ATTCAGAAGCCCGTGGATTAAGG - Intergenic
1052803854 9:32995124-32995146 ATTCTGCAGCCCATGGATCAAGG + Intronic
1053842934 9:42205068-42205090 ATTTGGAAGGCCAAGGAGGGTGG + Intergenic
1054768451 9:69062352-69062374 CTTCGGGAGCCCAAGGAGGGAGG - Intronic
1054971404 9:71091824-71091846 ATTTGAAAGCCCATAGAGAAAGG + Intronic
1054994583 9:71371187-71371209 ATTCTGCAGCCCATGGATCAAGG + Intronic
1055557090 9:77485658-77485680 GTTCTGAAGCCCATGGATCAAGG - Intronic
1055783444 9:79844792-79844814 ATTCGGCAGCCCATGGATCAAGG - Intergenic
1055793284 9:79946748-79946770 ATTCTTAAGCCCCTAGAGGATGG - Intergenic
1056274374 9:84979098-84979120 ATTCTGTAGCCCATGGATCAAGG + Intronic
1057305387 9:93909392-93909414 ATTCAGAGGCCCACGGAGCAGGG - Intergenic
1058927887 9:109686383-109686405 ATTCTGCAGCCCATGGATCAAGG - Intronic
1059049702 9:110910510-110910532 ATTCTGCAGCCCATGGATCAAGG + Intronic
1059092910 9:111380164-111380186 ATTCTGAAGCCCATGGATCAAGG - Intronic
1059129450 9:111730432-111730454 ATTCTGCAGCCCATGGATCAAGG - Intronic
1059158230 9:112009112-112009134 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1060640279 9:125232412-125232434 ATTGGGTAGTCCAGGGAGGAAGG - Intronic
1060844028 9:126820618-126820640 ATTCTGCAGCCCATGGACCAAGG + Intronic
1061895160 9:133643330-133643352 ATTCGGAAGCCCATGGAGGAGGG + Intronic
1062195560 9:135271796-135271818 CTTCGCAAGCCCATAAAGGAGGG - Intergenic
1062503721 9:136862300-136862322 ATTGGAAAGCCCATCGAGAAGGG - Exonic
1186395384 X:9203264-9203286 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1187074910 X:15924895-15924917 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1188329980 X:28857792-28857814 ATTCTGCAGCCCATGGATAAAGG + Intronic
1188456071 X:30367586-30367608 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1188835912 X:34954009-34954031 ATTCTGCAGCCCATGGATCAGGG + Intergenic
1189174648 X:38943650-38943672 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1189708514 X:43784383-43784405 ATTCTGCAGCCCATGGATCAAGG - Intronic
1189768568 X:44397690-44397712 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1189951685 X:46238637-46238659 ATTCTGCAGCCCATGCAGCAAGG + Intergenic
1190715517 X:53099735-53099757 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1192028468 X:67482737-67482759 ATTTGGCAGCCCATGGATCAAGG - Intergenic
1192084464 X:68082442-68082464 ATTCTGCAGCCCATGGATCAAGG - Intronic
1192701018 X:73473136-73473158 ATTCTGCAGCCCATGGATTAAGG - Intergenic
1193833483 X:86315430-86315452 ATTCTGCAGCCCATGGATCAAGG + Intronic
1193835741 X:86341545-86341567 ATTCTGCAGCCCATGGATCAAGG + Intronic
1194146139 X:90266592-90266614 ATTTGCAAGACCAAGGAGGATGG - Intergenic
1195593236 X:106656593-106656615 ATTCAGAAGCCCATGGATCAAGG - Intronic
1195690773 X:107622980-107623002 ATTCTGAAGCTCATGGATCAAGG - Intergenic
1195819037 X:108922833-108922855 ATTCGGCAGCCCATGGATCAAGG + Intergenic
1196619015 X:117800637-117800659 ATTCTGCAGCCCATGGATCAAGG - Intergenic
1196971538 X:121114776-121114798 ATTCTGCAGCCCATGGACCAAGG - Intergenic
1198542975 X:137660209-137660231 ATTCTGCAGCCCATGGATCAAGG + Intergenic
1200182393 X:154158707-154158729 ATTCCGAATCCCATGGGGGATGG - Intronic
1200188047 X:154195821-154195843 ATTCCGAATCCCATGGGGGATGG - Intergenic
1200193697 X:154232961-154232983 ATTCCGAATCCCATGGGGGATGG - Intronic
1200199452 X:154270765-154270787 ATTCCGAATCCCATGGGGGATGG - Intronic