ID: 1061895670

View in Genome Browser
Species Human (GRCh38)
Location 9:133646054-133646076
Sequence TCACTTCAAAACTTGGAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061895670_1061895676 21 Left 1061895670 9:133646054-133646076 CCCGGCTCCAAGTTTTGAAGTGA 0: 1
1: 0
2: 1
3: 22
4: 133
Right 1061895676 9:133646098-133646120 GTCTGTCCTGACTGCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061895670 Original CRISPR TCACTTCAAAACTTGGAGCC GGG (reversed) Intronic
903825900 1:26145648-26145670 TCACTCCAGACCTTCGAGCCTGG - Intergenic
904716117 1:32468876-32468898 CCAATTCAAAACTTTGAGACTGG - Intronic
904817307 1:33214254-33214276 TCTCTTCAATATTTGGAGCTAGG + Intergenic
911588702 1:99721292-99721314 TCACTTGAACACTTGAACCCAGG + Intronic
913087745 1:115454934-115454956 TCTCTTCAAAGCTTTGAGCCTGG + Intergenic
915790805 1:158668893-158668915 TCACTTCTCAACTTAGATCCTGG + Intronic
1066442755 10:35454483-35454505 CCCCTTGAAAACCTGGAGCCTGG + Intronic
1068155853 10:53197632-53197654 TCACTTCAACAAATGGAGCCAGG - Intergenic
1068772970 10:60842747-60842769 ATAATTCAAAACTTGGAGCCAGG - Intergenic
1068864152 10:61877490-61877512 TCACTTAAAATCTCTGAGCCTGG - Intergenic
1069041221 10:63697484-63697506 TCACCTGAAAACATGGAGACCGG - Intergenic
1069580269 10:69561114-69561136 TCCCTTCAGAGCTTGGATCCTGG + Intergenic
1069751999 10:70750757-70750779 TCTCTTCAAAATATGGTGCCGGG + Intronic
1070553206 10:77507641-77507663 TCCCTTCAGATCTTGGAGCTGGG - Intronic
1070700793 10:78600335-78600357 TGACTTCAAAGCTGGGAGCTTGG + Intergenic
1071353763 10:84772418-84772440 TCACATCAATAATTGGATCCTGG - Intergenic
1072252117 10:93589818-93589840 TCACTCCACCACTTGGAGGCTGG + Exonic
1072462652 10:95634073-95634095 TCTCTACAAAAATTGGGGCCAGG - Intronic
1076029525 10:127145678-127145700 TCACACCAACACTGGGAGCCCGG - Intronic
1077845339 11:6016925-6016947 TAACTTCAGAACTTGAAGACAGG + Intergenic
1078627061 11:12967391-12967413 CTATTTTAAAACTTGGAGCCAGG + Intergenic
1086202463 11:84220199-84220221 TCACTTCATAACTTGAACTCTGG + Intronic
1090027979 11:123183922-123183944 TCAAATCAAAACTCGAAGCCAGG - Intronic
1090620565 11:128557149-128557171 TCACTTACCAACATGGAGCCTGG + Intronic
1092110760 12:5962633-5962655 TCACTTGAACACTTGAACCCAGG - Intronic
1094816461 12:34191071-34191093 TCACCTTAAAACTTGGAACCTGG + Intergenic
1095100533 12:38177662-38177684 TCACCTTAAAACTTGGAAACTGG - Intergenic
1096559568 12:52425762-52425784 TCCCTCTGAAACTTGGAGCCTGG - Intronic
1099387416 12:82031368-82031390 TCACTTGAAACCTGGGAGGCAGG + Intergenic
1100646710 12:96539352-96539374 TCACTTAAAAGCTTGAAGCCGGG - Intronic
1101128676 12:101666199-101666221 TCTATTCAGAACTTGGACCCTGG + Intronic
1102019425 12:109671403-109671425 TCACTTCTGGACTTAGAGCCTGG - Intergenic
1103061550 12:117862653-117862675 ACAAAACAAAACTTGGAGCCTGG + Intronic
1103475735 12:121217223-121217245 ACACTTCTAAACTTGGATTCCGG + Exonic
1107549693 13:41463366-41463388 ACAGTTCAAAACTTGGAGTTGGG + Intronic
1108507452 13:51125368-51125390 TCACATCAAATATTGGTGCCTGG + Intergenic
1109560144 13:64036372-64036394 TCACTTGAAACCTGGGAGGCAGG + Intergenic
1112996866 13:105584961-105584983 TCACTTCAAAACTTCTTCCCTGG - Intergenic
1113054421 13:106252831-106252853 TCACTTGAACACTTGAACCCAGG - Intergenic
1114717163 14:24839059-24839081 TCCCTTCTCAACTGGGAGCCTGG + Intronic
1115172531 14:30525643-30525665 TCACTTCAGAGTTTGGTGCCAGG - Intergenic
1117498332 14:56327809-56327831 TCATTCCCACACTTGGAGCCAGG + Intergenic
1117692201 14:58319379-58319401 TCAATTAAAAACTTTGGGCCTGG - Intronic
1119304236 14:73594495-73594517 TCACTGAAAAACTTGGAAACTGG - Intronic
1119890649 14:78179598-78179620 ACAATTCCAAATTTGGAGCCAGG - Intergenic
1124435457 15:29645201-29645223 TCACTCCAAACCTTAAAGCCAGG + Intergenic
1125696683 15:41643539-41643561 TCACTTTAAAAATGGGAGCCAGG - Intronic
1128118336 15:65127155-65127177 TCACTTAAAAACTTTCAGCGGGG + Intronic
1128491022 15:68144550-68144572 TCAATTTAAAACATGGACCCTGG - Intronic
1129237471 15:74232394-74232416 TCTCTTCAAACCTAGGAGTCAGG - Intergenic
1129619026 15:77126737-77126759 TATCTTCAGAACTTGGACCCAGG + Intronic
1135234055 16:20739518-20739540 ACCCTTCAAAACGTGGAGCAAGG + Intronic
1136656559 16:31712763-31712785 TCACTTAAAATCTTGGGGTCAGG - Intergenic
1137034734 16:35560119-35560141 TGACTTTCAAATTTGGAGCCAGG - Intergenic
1139141076 16:64263369-64263391 TTACTGCAAAACTTCAAGCCAGG - Intergenic
1139562811 16:67754632-67754654 TCACTGCAAAATATGGGGCCGGG - Intronic
1140079237 16:71728850-71728872 TCACTTAAAAACTTGTAGCCAGG - Intergenic
1141122908 16:81375619-81375641 TCACTTTAAAACTGGGGGCCAGG - Intronic
1144954798 17:19013630-19013652 TCACTTCCCTGCTTGGAGCCTGG + Intronic
1148620326 17:49029864-49029886 TCACTTCAGAAGGTGGTGCCAGG - Intronic
1151067792 17:71171748-71171770 TAACTACAAAATTTTGAGCCTGG - Intergenic
1151081786 17:71337558-71337580 TCACTTCTCAACTCGGTGCCAGG + Intergenic
1151109662 17:71661251-71661273 TGAATTCAAACTTTGGAGCCCGG - Intergenic
1154009196 18:10560810-10560832 TCAGATGAAAACTTGCAGCCAGG + Intergenic
1155215577 18:23640765-23640787 TCACTTCTGAGCTTGGAGCTTGG + Intronic
1155228073 18:23747510-23747532 TCTCTCCAAAACCTGGAACCAGG + Intronic
1156123137 18:33869492-33869514 TCATTTACAAACTTAGAGCCTGG - Intronic
1157918558 18:51693396-51693418 TCACTTGGAAACATGGATCCTGG + Intergenic
1158946223 18:62449279-62449301 TCACTTGAACACTTGAACCCGGG - Intergenic
1159816735 18:73083855-73083877 TCACTTGAACACTTGAACCCAGG - Intergenic
1161486629 19:4539335-4539357 TCACATCAAAACACAGAGCCAGG - Intronic
1163130265 19:15268057-15268079 TCAGTTCTAAACTGAGAGCCTGG + Intronic
1163182385 19:15613822-15613844 TCCCTGCAAAGCCTGGAGCCAGG + Intergenic
1164857591 19:31537085-31537107 TCTCTTGAAAACTTGGAATCTGG + Intergenic
1164987807 19:32661636-32661658 TCACATCAAAACTTCTGGCCAGG - Intronic
925948071 2:8884842-8884864 TCAGTTCAAAACTTGGGAACTGG + Intronic
928373876 2:30759750-30759772 TAATTCCAAAACTAGGAGCCCGG - Intronic
932259774 2:70317435-70317457 ACTCTTCACAATTTGGAGCCAGG - Intergenic
935666360 2:105516354-105516376 TGACCTCCAAACCTGGAGCCAGG + Intergenic
937230499 2:120395735-120395757 GCCCTTCAGGACTTGGAGCCTGG - Intergenic
940784283 2:157965701-157965723 TCACTGCAACACTTGAACCCTGG + Intronic
948466234 2:238153073-238153095 GCACCTCAAAGCTGGGAGCCAGG - Intergenic
1169586213 20:7088671-7088693 TCTCTTCAAAAATTGGTGCTGGG + Intergenic
1170760902 20:19250758-19250780 TCCCTTCACCACTGGGAGCCAGG - Intronic
1171820214 20:29829160-29829182 TCACCTTAAAACTTGGAACCTGG + Intergenic
1171822498 20:29866284-29866306 TCACCTTAAATCTTGGAACCTGG + Intergenic
1171897622 20:30824005-30824027 TCACCTTAAAACTTGGAACCTGG - Intergenic
1174024227 20:47559374-47559396 TCCCTTCAAGATTTGGAGCAGGG + Intronic
1175692844 20:61077917-61077939 CCAATTCACAACCTGGAGCCTGG + Intergenic
1176412158 21:6454929-6454951 CCGCTTTAATACTTGGAGCCTGG - Intergenic
1178555318 21:33585507-33585529 TCAACTCAAAACTAGGAGGCTGG - Intronic
1179687652 21:43063251-43063273 CCGCTTTAATACTTGGAGCCTGG - Intronic
1179777175 21:43672609-43672631 TTACTTTAACACTTGGAGCCTGG + Intronic
1180324214 22:11353860-11353882 TCACCTTAAAACTTGGAACCTGG + Intergenic
1184957120 22:47896337-47896359 TCAATATAAAACTTGGAGGCCGG + Intergenic
949512343 3:4777614-4777636 TCACTTCTTAGCTTGGAGCAAGG - Intronic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
954421701 3:50422259-50422281 CCAGTTCAGAACTTGGAACCTGG + Intronic
954542151 3:51400669-51400691 TCACTTCAACACTTGGAGAATGG - Intronic
956111051 3:65870263-65870285 TCAATTCAATACTGGAAGCCTGG + Intronic
956703383 3:71978707-71978729 TAACTTCAACTCTTGGTGCCTGG + Intergenic
957280955 3:78150980-78151002 TAACTTAAAAACTTGGATACTGG - Intergenic
957348592 3:78994238-78994260 TGAATTCAAATCTTGGAGCCTGG - Intronic
957702504 3:83734567-83734589 TCACTTCAAAATTTGGATTTAGG - Intergenic
957747632 3:84365812-84365834 TCTCTTCAAAGCTTGCAGACAGG + Intergenic
958779654 3:98525075-98525097 TCACTACCAAACTAGGAGGCAGG + Intronic
962345607 3:134617005-134617027 TAAATTAAAAACTGGGAGCCAGG + Intronic
963241255 3:143004632-143004654 TCATTTTAAAACTAGAAGCCAGG - Intronic
965215163 3:165854150-165854172 CCAATTCAAGACTTGGGGCCTGG + Intergenic
971023982 4:22570135-22570157 ACATTTCAAAACTTGAAGACGGG - Intergenic
971253831 4:24995717-24995739 TCCCTTCAAGAGGTGGAGCCTGG - Intergenic
976390526 4:84499908-84499930 TCCCTTCAAAAGAAGGAGCCAGG - Intergenic
976919828 4:90424902-90424924 TGACTTCAAAATTTGAAACCAGG + Intronic
978746629 4:112202099-112202121 TCAGCTCAAAACTTGGGACCTGG + Intergenic
978993343 4:115115700-115115722 TCACATTAAAACATGGAGCAGGG + Intergenic
985847161 5:2358880-2358902 TAACTTCAAACATTGGAACCCGG + Intergenic
988183718 5:27833253-27833275 TCACTTCAAAACTTAGTGAATGG + Intergenic
988888331 5:35584063-35584085 TCATTTCAAAGCTTTGATCCAGG + Intergenic
991038841 5:62155477-62155499 TCACCTCCAAACCTGCAGCCAGG - Intergenic
997842119 5:137251379-137251401 TCACTGCAAGACTAGGAGCCAGG + Intronic
999692108 5:154157314-154157336 AAACTTCAAAACTTGGAGCTGGG + Intronic
1000539613 5:162524173-162524195 TAATTTCAAAACTTGAAGGCAGG - Intergenic
1002872650 6:1180987-1181009 TCACTCCAAAACCTGGAATCCGG + Intergenic
1005019277 6:21402218-21402240 TCAGCTGAAAACTTGGACCCTGG - Intergenic
1006201776 6:32299621-32299643 TTATTTAAAAACTTGGGGCCTGG + Intronic
1006867664 6:37222342-37222364 CCAGTTCAAATCTCGGAGCCGGG - Intronic
1008713723 6:54262550-54262572 TCGTTTCATAACTTTGAGCCAGG + Intronic
1013139855 6:107322217-107322239 CCACTTAAAAACTTGAGGCCAGG + Intronic
1014294736 6:119604415-119604437 TCACTTCCAAATTGGGATCCTGG + Intergenic
1017611576 6:156191990-156192012 GCTCTTTAAAAGTTGGAGCCAGG + Intergenic
1018218140 6:161550893-161550915 TGACTTCAAAATTTGTACCCAGG - Intronic
1035185401 7:157122142-157122164 TCTCTTCAAACGATGGAGCCTGG - Intergenic
1039423066 8:37460892-37460914 TCACTTCAAAACTGTCAGACAGG - Intergenic
1040468677 8:47718104-47718126 ACATTTCAAAGCTTGTAGCCGGG + Intronic
1040676927 8:49761758-49761780 TCACTTGAAACCTTGAACCCAGG - Intergenic
1046038066 8:108867955-108867977 TCACTTCAAAACTAGGCAGCTGG + Intergenic
1047998080 8:130355997-130356019 TCACTTAGGAACTTGGAACCAGG - Intronic
1048676086 8:136782262-136782284 TCAGTTGAAATCTTGTAGCCAGG + Intergenic
1049783887 8:144441295-144441317 ACACTTAAAAACTCGGGGCCAGG + Intronic
1050012388 9:1198285-1198307 TTATTTCAAAACTTTGTGCCAGG - Intergenic
1050351629 9:4745448-4745470 TCACTTGAACACTTGAACCCGGG + Intergenic
1053750188 9:41245810-41245832 TCACCTTAAAACTTGGAACCTGG - Intergenic
1054255687 9:62810149-62810171 TCACCTTAAAACTTGGAACCTGG - Intergenic
1054335624 9:63805458-63805480 TCACCTTAAAACTTGGAACCTGG + Intergenic
1055944770 9:81683052-81683074 TCACTTTAAAACTTCCAGACAGG + Intronic
1057339703 9:94188963-94188985 TCAGGTCAAAACTCAGAGCCAGG + Intergenic
1058078354 9:100673568-100673590 TCACTTGAGAACTTGGAGCAGGG + Intergenic
1061895670 9:133646054-133646076 TCACTTCAAAACTTGGAGCCGGG - Intronic
1203371874 Un_KI270442v1:314432-314454 TCACCTTAAAACTTGGAACCTGG + Intergenic
1203375558 Un_KI270442v1:372909-372931 TCACCTTAAAACTTGGAACCTGG + Intergenic
1186306531 X:8265748-8265770 TCACCCCAAAACATGGAGACAGG + Intergenic
1196603898 X:117633838-117633860 TCAATTCAACACTTGGACACAGG + Intergenic
1198826543 X:140704217-140704239 TCATTTCAAGATTTGAAGCCAGG + Intergenic
1199088485 X:143662222-143662244 TCATTTCAAAACATGGTGCTGGG + Intergenic
1199689627 X:150298503-150298525 TCACTTCACACCATGGAGCCAGG + Intergenic
1201761409 Y:17543206-17543228 TCACCTTAAAACTTGGAAACTGG + Intergenic
1201840143 Y:18362784-18362806 TCACCTTAAAACTTGGAAACTGG - Intergenic