ID: 1061896885

View in Genome Browser
Species Human (GRCh38)
Location 9:133652841-133652863
Sequence CCGTGGCATGCACAGTGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061896877_1061896885 14 Left 1061896877 9:133652804-133652826 CCTTGTAGTGGACGACAGGGACT 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1061896885 9:133652841-133652863 CCGTGGCATGCACAGTGGCGTGG 0: 1
1: 0
2: 0
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061896885 Original CRISPR CCGTGGCATGCACAGTGGCG TGG Intronic
900110102 1:1001705-1001727 CCGCCGCTTGCACAGGGGCGCGG + Intergenic
900673992 1:3872662-3872684 CCGTGGCAGGGACAGGGCCGTGG - Intronic
904613688 1:31738680-31738702 CCATGGCATGGGCAGTGGTGGGG - Intronic
910518407 1:88088858-88088880 CTGTGGGTTGCACAGTTGCGTGG + Intergenic
912410768 1:109479441-109479463 CCGTGGCATGGACAGGGCCAGGG + Exonic
915328151 1:155091979-155092001 ACGTGGCAGGGACAGAGGCGTGG + Intergenic
915445049 1:155969790-155969812 CTGTGGCAGTCACAGTGGGGGGG + Intronic
917024941 1:170631497-170631519 CCGTGGGTTGCACAGTTCCGTGG + Intergenic
918168661 1:181974824-181974846 CCGTGGGTTGCACAGTTCCGTGG - Intergenic
921253370 1:213317940-213317962 CTGTGTCATGCACAGTTGCCTGG - Intergenic
921279366 1:213550504-213550526 CCGGTGCATACAGAGTGGCGAGG - Intergenic
923024978 1:230196834-230196856 CCATGGCATGCACAGGTGAGGGG + Intronic
924603269 1:245510022-245510044 CAGTGCCATGAACAGTGGAGTGG + Intronic
1068726083 10:60305013-60305035 CTGTGGCAGGCACAGTGGGTGGG + Intronic
1071260044 10:83911453-83911475 CAGTGACAGGCACAGTGGAGAGG + Intergenic
1071858032 10:89645246-89645268 ACTGGGCATGCTCAGTGGCGGGG - Exonic
1073509649 10:104035080-104035102 CCGTGGCAGGGACAGAGGTGGGG - Intronic
1076271042 10:129152445-129152467 TCGTGGCATGCTCTGTGGTGGGG + Intergenic
1079425963 11:20342646-20342668 CCGTGGGTTGCACAGTTCCGTGG - Intergenic
1094846573 12:34363979-34364001 CCATGGCATGTGCAGTGGTGAGG + Intergenic
1094848471 12:34371820-34371842 CCCTTGCATGCACGGTGGGGAGG + Intergenic
1094852512 12:34388592-34388614 CCAGCGCATGCACAGTGGGGAGG + Intergenic
1094852654 12:34389205-34389227 CCCAGGCATGCACGGTGGGGAGG - Intergenic
1094853097 12:34391080-34391102 CCCACGCATGCACAGTGGGGAGG - Intergenic
1094854392 12:34396500-34396522 CCCTCGCATGCACGGTGGGGAGG - Intergenic
1094855154 12:34399608-34399630 CCTGTGCATGCACAGTGGGGAGG - Intergenic
1094855471 12:34400976-34400998 CCTGTGCATGCACAGTGGGGAGG - Intergenic
1112431541 13:99354790-99354812 CCGTGGCATGCAGATTGGATTGG + Intronic
1114065352 14:19054881-19054903 CGGTGGCTTGCACAGGGTCGGGG + Intergenic
1114096910 14:19345121-19345143 CGGTGGCTTGCACAGGGTCGGGG - Intergenic
1114102019 14:19388926-19388948 CCCTGGCATGCACAGGCGCCAGG - Intergenic
1120925898 14:89796823-89796845 CCGTGGCCTGCAGTGTGGAGAGG + Exonic
1123491268 15:20784262-20784284 CGGTGGCTTGCACAGGGTCGGGG - Intergenic
1123547770 15:21353353-21353375 CGGTGGCTTGCACAGGGTCGGGG - Intergenic
1126096377 15:45093777-45093799 GCGTGGCAAGCAAAGTGGGGAGG - Exonic
1127995288 15:64150359-64150381 CCGTGACATGCAGAGAGGCGAGG - Intergenic
1129322862 15:74784239-74784261 TCCTGACATGCACAGTGGAGGGG + Intronic
1129542582 15:76363033-76363055 CTGTGGCAGGCACAGTGCTGGGG - Intronic
1131399216 15:92111101-92111123 CTGTGGGAAGCACAGTGGTGGGG - Intronic
1132176147 15:99716760-99716782 CTGTTGCATGCACAGTGCTGTGG + Intronic
1202956100 15_KI270727v1_random:80583-80605 CGGTGGCTTGCACAGGGTCGGGG - Intergenic
1133039759 16:3054295-3054317 CAGATGCATGCACAGAGGCGGGG + Intronic
1133039801 16:3054563-3054585 CAGATGCATGCACAGAGGCGGGG + Intronic
1133039823 16:3054699-3054721 CAGATGCATGCACAGAGGCGGGG + Intronic
1133039834 16:3054767-3054789 CAGATGCATGCACAGAGGCGGGG + Intronic
1133039840 16:3054799-3054821 CAGATGCATGCACAGAGGCGGGG + Intronic
1137270525 16:46899849-46899871 GCCTGCCATGCACAGTGGCAGGG - Intronic
1137609220 16:49807853-49807875 CCGGGGCAGGGACAGTGGAGAGG - Intronic
1138340344 16:56285055-56285077 CCGTGGCGTGCAGAGTTGAGTGG + Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1152113177 17:78368569-78368591 CGGTGGCATACACAGGGGAGGGG + Intergenic
1152818699 17:82424514-82424536 CCGTGGCAGGTACAGGGGCGCGG + Intronic
1153319764 18:3760942-3760964 CTGTGGCTTGCACAGTGTCACGG - Intronic
1153431752 18:5025043-5025065 CCATGGCATGCACAGGGTTGGGG - Intergenic
1156341654 18:36214996-36215018 CCTTGGCCTTCACAGTGGCCCGG + Intronic
926119439 2:10234281-10234303 GCCTGGCAAGCACAGTGGTGGGG + Intergenic
926692956 2:15749834-15749856 CAGTGGCAGGCACATTGGAGGGG - Intergenic
927435063 2:23059620-23059642 CTGTGACATGCACTGTGGCCAGG + Intergenic
927475452 2:23411085-23411107 CTGTGCCAGGCACAGTGGCATGG + Intronic
928556987 2:32437121-32437143 CCGAGGCAGGCAGAGTGGCTGGG - Intronic
938482613 2:131673883-131673905 CGGTGGCTTGCACAGGGTCGGGG + Intergenic
947931791 2:233970763-233970785 CCGTGGCATGATAAGTGGCAGGG + Intronic
1168736058 20:137799-137821 CTGTGGAATGCACAGTGGCATGG - Intergenic
1171154480 20:22859635-22859657 CCTTGGCATGGACAATGGCCTGG + Intergenic
1175405014 20:58720201-58720223 CCCTGGCACCCACAGGGGCGGGG + Intergenic
1175414072 20:58789991-58790013 CCGTGGTAGGCACTGTGGGGGGG + Intergenic
1175943008 20:62546501-62546523 CCGTGGGAAGCGCTGTGGCGTGG + Intergenic
1176447351 21:6831554-6831576 CGGTGGCTTGCACAGGGTCGGGG + Intergenic
1176825519 21:13696580-13696602 CGGTGGCTTGCACAGGGTCGGGG + Intergenic
1180483843 22:15777501-15777523 CGGTGGCTTGCACAGGGTCGGGG + Intergenic
1183737449 22:39651677-39651699 CCCTGGCAAGGACAGTGCCGGGG - Intronic
1184706495 22:46217159-46217181 CCTAGGCTTGCACAGTGGGGAGG - Intronic
950712355 3:14821335-14821357 CCGTGGCTTGGTCAGTGGCAAGG - Exonic
956608248 3:71095033-71095055 CCGTGTCATGCAAAATGGTGAGG + Intronic
959495477 3:107046052-107046074 GCTTGCCATGCACAGTGGCAGGG + Intergenic
968493274 4:901745-901767 CCTTGGCCTGGGCAGTGGCGGGG + Intronic
968494035 4:905634-905656 CCGTGGCATGGCCTGGGGCGTGG - Intronic
968523499 4:1045122-1045144 CCCTGGCCTGCACTGTGGGGAGG - Intergenic
985676639 5:1234841-1234863 CTGTGGCATGGGCAGTGGCCCGG + Intronic
992597425 5:78360517-78360539 ACCGGGCATGCTCAGTGGCGCGG + Intergenic
997697293 5:135871741-135871763 CTGTGGCCTGCACAGGGGTGCGG - Intronic
998367641 5:141641137-141641159 CCCTGGCATCCAGAGTGGGGTGG + Exonic
1003084284 6:3049095-3049117 CTGTGGCCTGCACAGTGGTCAGG + Intergenic
1004660695 6:17706642-17706664 CCGTGACACACACAGAGGCGGGG - Exonic
1005989357 6:30893434-30893456 CCGTGGCATGTGGAGTGGCGGGG + Intronic
1013208283 6:107964326-107964348 CAGTGGCATGAGCAGTGGCATGG + Intergenic
1019771069 7:2883787-2883809 CCGTGGCAGGGCCTGTGGCGGGG + Intergenic
1021940511 7:25674286-25674308 CTTTGGCATGCACAGTGCCAGGG - Intergenic
1024549790 7:50553096-50553118 ACCTCACATGCACAGTGGCGTGG - Intronic
1026186341 7:68084528-68084550 CCTTGGCCTGCACAGTAGCTGGG + Intergenic
1028459101 7:91071511-91071533 CCGTGGGTTGCACAGTTCCGTGG - Intronic
1034413892 7:150955163-150955185 CCATGGCAGGCACAGGAGCGGGG + Intronic
1038454851 8:27666622-27666644 CCGTGGGAGGCACATTGGCGTGG - Intronic
1038532737 8:28331638-28331660 CTGTGGCAGGCACAATGGCAGGG - Intronic
1049190493 8:141284877-141284899 CCGTGGCAGGGACAGGGGCGGGG - Intronic
1053138646 9:35667959-35667981 CCATGGAAGGCACAGTGGAGTGG - Intronic
1061896885 9:133652841-133652863 CCGTGGCATGCACAGTGGCGTGG + Intronic
1061925993 9:133806314-133806336 CCCTGGCATGCACAGAGATGTGG - Intronic
1062218798 9:135403442-135403464 CCGTGGCAGGCAGTGGGGCGTGG - Intergenic
1203521839 Un_GL000213v1:52977-52999 CGGTGGCTTGCACAGGGTCGGGG - Intergenic
1185643023 X:1598813-1598835 CCCCGGGATGCACAGCGGCGCGG - Intronic
1187027485 X:15450972-15450994 CAGTGGCTTGCACAGTGGCCAGG + Intronic
1194523076 X:94942580-94942602 CCGTGGGTTGCACAGTTCCGTGG - Intergenic
1198583688 X:138096184-138096206 CCCTGGCCTCCCCAGTGGCGGGG + Intergenic