ID: 1061898203

View in Genome Browser
Species Human (GRCh38)
Location 9:133659409-133659431
Sequence GAAGCACTTGGTACCACGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1011
Summary {0: 1, 1: 0, 2: 3, 3: 64, 4: 943}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061898203_1061898213 17 Left 1061898203 9:133659409-133659431 CCAGGCGTGGTACCAAGTGCTTC 0: 1
1: 0
2: 3
3: 64
4: 943
Right 1061898213 9:133659449-133659471 GCTGCCTCAGCTGGCCTGGGTGG 0: 1
1: 0
2: 5
3: 62
4: 630
1061898203_1061898211 13 Left 1061898203 9:133659409-133659431 CCAGGCGTGGTACCAAGTGCTTC 0: 1
1: 0
2: 3
3: 64
4: 943
Right 1061898211 9:133659445-133659467 TGAAGCTGCCTCAGCTGGCCTGG 0: 1
1: 0
2: 2
3: 28
4: 258
1061898203_1061898212 14 Left 1061898203 9:133659409-133659431 CCAGGCGTGGTACCAAGTGCTTC 0: 1
1: 0
2: 3
3: 64
4: 943
Right 1061898212 9:133659446-133659468 GAAGCTGCCTCAGCTGGCCTGGG 0: 1
1: 0
2: 3
3: 30
4: 320
1061898203_1061898214 18 Left 1061898203 9:133659409-133659431 CCAGGCGTGGTACCAAGTGCTTC 0: 1
1: 0
2: 3
3: 64
4: 943
Right 1061898214 9:133659450-133659472 CTGCCTCAGCTGGCCTGGGTGGG 0: 1
1: 0
2: 9
3: 55
4: 488
1061898203_1061898209 8 Left 1061898203 9:133659409-133659431 CCAGGCGTGGTACCAAGTGCTTC 0: 1
1: 0
2: 3
3: 64
4: 943
Right 1061898209 9:133659440-133659462 CGTCCTGAAGCTGCCTCAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061898203 Original CRISPR GAAGCACTTGGTACCACGCC TGG (reversed) Intergenic
900219628 1:1500812-1500834 CAGGCACCTGCTACCACGCCCGG - Intergenic
900517256 1:3088606-3088628 CAAGCACCTGCCACCACGCCTGG + Intronic
901372043 1:8807192-8807214 CAGGCACGTGCTACCACGCCTGG + Intronic
901749443 1:11396949-11396971 CAGGCACTTGCCACCACGCCTGG - Intergenic
902234044 1:15046579-15046601 GAAGCATTTGGCACCGGGCCTGG + Intronic
902299969 1:15494718-15494740 CAAGCACCTGCCACCACGCCTGG - Intronic
902408757 1:16200756-16200778 CAGGCACTTGCCACCACGCCTGG - Intronic
902654001 1:17855020-17855042 CAGGCACTTGCTACCATGCCTGG + Intergenic
903437037 1:23358029-23358051 CAGGCGCTTGCTACCACGCCCGG + Intergenic
903890580 1:26567672-26567694 GAAGCACTAGAGACCAGGCCAGG - Intronic
903892890 1:26581691-26581713 CAGGCACTTGCCACCACGCCTGG - Intergenic
903913456 1:26745906-26745928 CAAGCACATGCCACCACGCCCGG - Intronic
904010894 1:27389773-27389795 CAAGCACGTGTCACCACGCCTGG - Intergenic
904217982 1:28939584-28939606 CAGGCACTTGACACCACGCCCGG + Intronic
904555812 1:31363324-31363346 CAAGCACCTGCCACCACGCCTGG + Intronic
904746045 1:32711917-32711939 CAGGCACTTGCCACCACGCCAGG + Intergenic
904791471 1:33025275-33025297 AATGCACTTGGTACAACACCTGG + Intronic
905253974 1:36668178-36668200 CTAGCACTTTGTACCAAGCCTGG - Intergenic
905442113 1:38002239-38002261 CAGGCACCTGCTACCACGCCCGG + Intronic
905443336 1:38008287-38008309 CAGGCACCTGCTACCACGCCTGG - Intergenic
905622701 1:39462570-39462592 CAAGCACTTGCCACCACACCTGG - Intronic
905691547 1:39946867-39946889 CAAGCACATGCTGCCACGCCTGG - Intergenic
905747498 1:40430897-40430919 CAGGCACGTGCTACCACGCCTGG - Intergenic
905844650 1:41218702-41218724 AAAGCACTTAATACCATGCCTGG - Intronic
906298873 1:44666984-44667006 CAGGCACATGGTACCACACCTGG + Intronic
906468541 1:46106916-46106938 CAAGCACGTGCAACCACGCCTGG + Intronic
906629234 1:47351220-47351242 CAAGCACATGCCACCACGCCTGG + Intronic
907180451 1:52565148-52565170 CAGGCACATGCTACCACGCCTGG - Intergenic
907420826 1:54346180-54346202 CAAGCACATGGTGCCGCGCCTGG - Intronic
907768405 1:57435189-57435211 CAGGCACTTGCCACCACGCCCGG + Intronic
907899151 1:58721495-58721517 GAAGCACCTAGTGCCAGGCCAGG - Intergenic
908205057 1:61838495-61838517 CAGGCACCTGCTACCACGCCTGG + Intronic
908343517 1:63207396-63207418 AAGGCACTTGCCACCACGCCCGG + Intergenic
909097446 1:71305465-71305487 CAGGCACATGCTACCACGCCTGG + Intergenic
910296265 1:85648572-85648594 CAGGCACCTGCTACCACGCCTGG + Intergenic
910420704 1:87058914-87058936 CAGGCACCTGCTACCACGCCTGG - Intronic
910945980 1:92592098-92592120 CAGGCACCTGCTACCACGCCCGG - Intronic
911192213 1:94959461-94959483 CAGGCACCTGCTACCACGCCCGG + Intergenic
911264304 1:95725296-95725318 AAAGCTCTTGGCACCATGCCTGG + Intergenic
912332736 1:108834602-108834624 GAATCACTTGGCATCACCCCTGG + Intronic
912463102 1:109850431-109850453 GCAGCACTTGGTGCCCCGCCCGG - Intergenic
912602993 1:110957328-110957350 CAGGCGCTTGCTACCACGCCCGG - Intronic
912929301 1:113942201-113942223 CAGGCACCTGCTACCACGCCCGG + Intronic
913365408 1:118032732-118032754 CAAGCACCTGCCACCACGCCTGG + Intronic
913678240 1:121163074-121163096 GAAGCACTTGGAACAATGCCTGG + Intergenic
914030080 1:143950714-143950736 GAAGCACTTGGAACAATGCCTGG + Intronic
914159369 1:145117237-145117259 GAAGCACTTGGAACAATGCCTGG - Intergenic
914722319 1:150299595-150299617 CAGGCACTTGCCACCACGCCTGG + Intronic
914734934 1:150406855-150406877 CAAGCATGTGCTACCACGCCCGG + Intronic
914740456 1:150460543-150460565 CAGGCACCTGCTACCACGCCCGG + Intronic
914760065 1:150591536-150591558 CAGGCACGTGCTACCACGCCCGG + Intergenic
914861362 1:151388998-151389020 CAAGCACCTGCCACCACGCCCGG + Intergenic
914902474 1:151718222-151718244 AAAGCACTTGGCACAAAGCCTGG - Intronic
915212730 1:154322639-154322661 CAGGCACCTGCTACCACGCCTGG + Intronic
915434820 1:155896324-155896346 CAAGCATGTGCTACCACGCCTGG - Intergenic
915459597 1:156061925-156061947 CAAGCACCTGCCACCACGCCCGG + Intronic
915506899 1:156363340-156363362 CAGGCACTTGCTACCACACCTGG + Intronic
916006245 1:160663875-160663897 CAAGCACATGCTACCAGGCCTGG - Intergenic
917158169 1:172026794-172026816 CAGGCACCTGCTACCACGCCTGG + Intronic
917352665 1:174094186-174094208 CAGGCACTTGCCACCACGCCTGG + Intergenic
917524403 1:175774359-175774381 CAGGCGCTTGCTACCACGCCTGG - Intergenic
917554427 1:176069043-176069065 CAAGCACGTGCCACCACGCCTGG - Intronic
917781376 1:178400891-178400913 CAAGCACATGCCACCACGCCTGG + Intronic
917927810 1:179803709-179803731 CAGGCACGTGCTACCACGCCCGG + Intronic
918005825 1:180541317-180541339 GAAGCACTTAGAACAATGCCTGG + Intergenic
919648163 1:200117854-200117876 CAGGCACTTGCCACCACGCCTGG + Intronic
919872234 1:201830793-201830815 GGAGCACTGGGTACCACTCAGGG - Intronic
919883517 1:201916369-201916391 CAAGCACATGCCACCACGCCTGG - Intronic
920000487 1:202795069-202795091 CAGGCACCTGCTACCACGCCCGG - Intronic
920329274 1:205193726-205193748 TAGGCACATGCTACCACGCCTGG - Intronic
920465547 1:206181598-206181620 GAAGCACTTGGAACAATGCCTGG + Intergenic
920712309 1:208306945-208306967 GAAGCAATTATTACCATGCCTGG - Intergenic
921203558 1:212828966-212828988 GAAGCTCTGGGTTCCAGGCCAGG + Intergenic
921292029 1:213667124-213667146 GAAGCCCTGGGTTCCAGGCCTGG - Intergenic
921699021 1:218246163-218246185 CAGGCACTTGCCACCACGCCAGG - Intergenic
922295418 1:224245808-224245830 CAGGCACGTGCTACCACGCCCGG - Intronic
922312652 1:224410136-224410158 CAAGCGCTTGCCACCACGCCTGG - Intronic
922346613 1:224701683-224701705 CAAGCACTTTGTACAACGTCTGG - Intronic
922454648 1:225764900-225764922 TAAGCACCTGCCACCACGCCCGG - Intergenic
922510260 1:226160232-226160254 CAGGCACCTGCTACCACGCCTGG + Intronic
922736942 1:227990705-227990727 CAGGCACCTGCTACCACGCCCGG - Intergenic
923165411 1:231356590-231356612 CAGGCACTTGCCACCACGCCCGG - Intergenic
924107387 1:240662767-240662789 CAGGCACATGCTACCACGCCCGG - Intergenic
924356132 1:243178184-243178206 CAAGCACTTGCCACCACGCCCGG - Intronic
1062896303 10:1105926-1105948 GAGGCACCTGCCACCACGCCTGG + Intronic
1063926583 10:10983708-10983730 TAGGCACTTGCCACCACGCCTGG + Intergenic
1064455600 10:15484812-15484834 CAGGCACCTGCTACCACGCCCGG + Intergenic
1065093506 10:22259087-22259109 GAGGCACTTGCCACCACACCTGG + Intergenic
1065532899 10:26690307-26690329 CAGGCACTTGTCACCACGCCTGG - Intergenic
1065820212 10:29518243-29518265 CAAGCACTTACTACCATGCCTGG - Intronic
1065915034 10:30347746-30347768 CAGGCACGTGGCACCACGCCTGG - Intronic
1066079616 10:31917263-31917285 CAGGCACGTGCTACCACGCCTGG - Intronic
1066201893 10:33149955-33149977 CAGGCACGTGATACCACGCCTGG + Intergenic
1066586412 10:36941703-36941725 CAGGCACCTGCTACCACGCCTGG - Intergenic
1067007645 10:42680058-42680080 CAGGCACCTGCTACCACGCCTGG - Intergenic
1067458912 10:46443122-46443144 GAGGCACATGCCACCACGCCTGG + Intergenic
1067496583 10:46766146-46766168 CAGGCACTTGCTATCACGCCTGG - Intergenic
1067598072 10:47574256-47574278 CAGGCACTTGCTATCACGCCTGG + Intergenic
1067628284 10:47941510-47941532 GAGGCACATGCCACCACGCCTGG - Intergenic
1068375706 10:56177214-56177236 CAGGCACCTGCTACCACGCCCGG + Intergenic
1068449116 10:57164001-57164023 CAGGCACCTGCTACCACGCCTGG - Intergenic
1068606539 10:59011379-59011401 GAAGCACTTAGCACAATGCCTGG + Intergenic
1068700297 10:60012712-60012734 CAGGCACTTGCCACCACGCCTGG + Intergenic
1069041988 10:63705358-63705380 GAGGCACATGCCACCACGCCTGG + Intergenic
1069416120 10:68202288-68202310 CAGGCACCTGCTACCACGCCTGG - Intronic
1069482587 10:68797230-68797252 CAGGCACTTGCCACCACGCCTGG - Intergenic
1069558585 10:69413871-69413893 GAAGCCCTTAGCACCATGCCTGG - Intronic
1069567052 10:69470620-69470642 GTAGCACTTGCCACCATGCCTGG - Intronic
1069688396 10:70334005-70334027 CAGGCACTTGCCACCACGCCTGG - Intronic
1069705305 10:70455777-70455799 GAAGCACTCAGCACCATGCCTGG - Intergenic
1069975289 10:72207952-72207974 CAAGCACTCACTACCACGCCTGG + Intronic
1070223067 10:74471215-74471237 CAAGCACCTGCCACCACGCCTGG + Intronic
1070421062 10:76237931-76237953 CAAGCACGTGCCACCACGCCTGG + Intronic
1071075268 10:81743166-81743188 CAAGCACCTGACACCACGCCTGG - Intergenic
1072336827 10:94404501-94404523 CAAGCACCTGCCACCACGCCTGG - Intronic
1072473027 10:95731923-95731945 CAGGCACCTGCTACCACGCCCGG + Intronic
1072497945 10:95981247-95981269 CAGGCACGTGCTACCACGCCTGG - Intronic
1072583290 10:96759101-96759123 CAAGCACCTGCCACCACGCCTGG + Intergenic
1072734369 10:97869160-97869182 GAAGGACTTGGAGCCATGCCTGG + Exonic
1073882376 10:107998078-107998100 CAGGCACCTGCTACCACGCCCGG - Intergenic
1074363030 10:112838097-112838119 GAAGCACTCAGTACCAGGCCAGG - Intergenic
1074371800 10:112906404-112906426 CAAGCACATGCCACCACGCCCGG - Intergenic
1074425718 10:113349466-113349488 CAGGCACCTGCTACCACGCCTGG - Intergenic
1075145564 10:119880104-119880126 CAGGCACGTGCTACCACGCCTGG + Intronic
1075338210 10:121624103-121624125 GAAGTACTTGCCACCACGCCTGG - Intergenic
1076038543 10:127222806-127222828 CAAGCACTTGCCACTACGCCTGG + Intronic
1076301229 10:129428281-129428303 GAGGCACTTGGTACCTCTGCAGG + Intergenic
1076904030 10:133353430-133353452 GAAGCACCTGGTGCCAAGCCCGG + Intergenic
1077004449 11:345944-345966 AAAGCACTTAGTACCATGCTTGG - Intergenic
1077055270 11:588991-589013 CAGGTACGTGGTACCACGCCCGG - Intronic
1077263821 11:1638884-1638906 CAAGCACCTGCCACCACGCCTGG - Intergenic
1077897028 11:6460823-6460845 GAAGCACTTAGAATCATGCCTGG - Intronic
1077990872 11:7410995-7411017 CAGGCACCTGGCACCACGCCTGG + Intronic
1078016413 11:7618722-7618744 CAGGCACTTGCCACCACGCCCGG + Intronic
1078506621 11:11954410-11954432 CAAGCACATGCCACCACGCCCGG + Intronic
1079050813 11:17157315-17157337 CAAGCACTTGCCACCACGCCTGG - Intronic
1079181753 11:18200181-18200203 CAGGCACCTGCTACCACGCCTGG + Intronic
1080542674 11:33283251-33283273 TAAGCACTTGCCACCACTCCCGG + Intronic
1080643395 11:34171430-34171452 CAGGCACATGCTACCACGCCTGG - Intronic
1081119012 11:39241291-39241313 CAAGCACTTGCCACCACGCCCGG + Intergenic
1081178486 11:39958504-39958526 GAGGCACTTGCCACCACGCCTGG - Intergenic
1081243131 11:40731174-40731196 CAGGCACTTGCCACCACGCCCGG - Intronic
1081496504 11:43616529-43616551 GAAGCACTTAGAACAATGCCTGG - Intronic
1082843123 11:57705509-57705531 CAGGCACGTGCTACCACGCCTGG - Intronic
1082934292 11:58640276-58640298 GAAGCACTTGTTCCCAGGTCAGG - Intergenic
1083244396 11:61415093-61415115 CAGGCACTTGCCACCACGCCCGG - Intronic
1083399848 11:62415909-62415931 CAAGCACCTGCCACCACGCCCGG + Intronic
1083798195 11:65030639-65030661 CAGGCACTTGCCACCACGCCTGG + Intronic
1084070773 11:66732821-66732843 CAGGCACTTGCCACCACGCCCGG - Intergenic
1084406690 11:68978412-68978434 GGAGCACTTGGTACCAGCACTGG - Intergenic
1085118929 11:73954485-73954507 CAGGCACCTGCTACCACGCCCGG - Intronic
1085132698 11:74055086-74055108 GAAACACGTGGTGCCATGCCTGG - Intronic
1085304833 11:75479441-75479463 AAAGCACTTGGAACAATGCCTGG - Intronic
1085609879 11:77937599-77937621 GAAGCACGTGTCACCATGCCCGG - Intronic
1085759752 11:79231935-79231957 AAAGCATGTGCTACCACGCCTGG - Intronic
1086110366 11:83192638-83192660 AAAGCACTTAGTACAATGCCAGG + Intergenic
1086358965 11:86037400-86037422 CAGGCACCTGCTACCACGCCCGG + Intronic
1086429019 11:86717379-86717401 GAGGCACCTGCCACCACGCCAGG + Intergenic
1086484434 11:87283189-87283211 CAGGCACCTGGTACCACACCTGG - Intronic
1087191801 11:95262481-95262503 GAAGCACTTAGAACCATGCCCGG + Intergenic
1087380890 11:97403535-97403557 CAAGCACATGTTACCACACCTGG + Intergenic
1088016938 11:105072171-105072193 CAAGCACATGCTACCACGGCTGG + Intronic
1088019492 11:105102073-105102095 CAAGCACATGCTACCACGGCTGG + Intergenic
1088387316 11:109274154-109274176 TAGGCACTTGCCACCACGCCTGG + Intergenic
1088394450 11:109351037-109351059 GTAGCACTGGGTACCACGGCAGG - Intergenic
1088744601 11:112795121-112795143 CAAGCACCTGCCACCACGCCTGG + Intergenic
1088820377 11:113451631-113451653 CAGGCACCTGCTACCACGCCCGG + Intronic
1089739994 11:120575818-120575840 CAGGCACATGCTACCACGCCTGG - Intronic
1090405537 11:126473934-126473956 CAAGCACGTGGTACCATGCCCGG + Intronic
1090448446 11:126784945-126784967 GAAGCACTTCCTTCCAAGCCCGG + Intronic
1090645062 11:128760668-128760690 CAAGCACATGGCACCACACCTGG + Intronic
1090687508 11:129140121-129140143 GAAGCACCAAGTACCACCCCTGG + Intronic
1091414249 12:267124-267146 GTAGCACTTAGCACCACGTCTGG - Intergenic
1091642614 12:2248939-2248961 GAAGCACCTGGCACCGTGCCTGG + Intronic
1092346310 12:7717984-7718006 CAAGCACCTGCCACCACGCCTGG + Intergenic
1092572785 12:9743487-9743509 TAAGCACCTGCCACCACGCCTGG + Intergenic
1092809365 12:12257822-12257844 TAGGCACGTGCTACCACGCCCGG - Intronic
1092878242 12:12867278-12867300 CAGGCACATGGCACCACGCCTGG + Intergenic
1093819741 12:23599151-23599173 GAAACACATGGTACCACATCGGG + Intronic
1093936271 12:25004079-25004101 GAAGAGCTTAGTACCATGCCTGG + Intergenic
1094110777 12:26860090-26860112 CAGGCACTTGCCACCACGCCTGG - Intergenic
1094558388 12:31525848-31525870 CAGGCACTTGCTACCACACCTGG - Intronic
1095172492 12:39052300-39052322 CAGGCACCTGGCACCACGCCTGG - Intergenic
1095206667 12:39446186-39446208 CAGGCACCTGCTACCACGCCTGG + Intergenic
1095405481 12:41862513-41862535 TAGGCACGTGCTACCACGCCTGG - Intergenic
1095723090 12:45422714-45422736 CAAGCACGTGCTACCACACCTGG + Intronic
1095812952 12:46390595-46390617 GAAGCACTTAGAACCATGCCTGG + Intergenic
1095889452 12:47222277-47222299 CAGGCACGTGCTACCACGCCCGG - Intronic
1096047854 12:48580122-48580144 CAAGCACTTGCCACCACGCCTGG - Intergenic
1096129833 12:49149348-49149370 CAGGCACTTGCCACCACGCCCGG + Intergenic
1096354368 12:50927965-50927987 CAGGCACATGCTACCACGCCTGG + Intronic
1096927905 12:55169104-55169126 GAGGCACGTGCCACCACGCCCGG + Intergenic
1097408765 12:59225125-59225147 CAGGCACCTGCTACCACGCCCGG + Intergenic
1097754480 12:63394115-63394137 CAGGCACTTGCCACCACGCCTGG - Intergenic
1097930582 12:65180085-65180107 CAGGCACATGGCACCACGCCCGG + Intronic
1097995439 12:65882711-65882733 AAAGCACTTGGCACAATGCCTGG + Intronic
1099055866 12:77839928-77839950 CAAGCACTTGCCACCACGCCTGG - Intronic
1099450949 12:82805648-82805670 TAGGCACCTGGCACCACGCCCGG + Intronic
1100388410 12:94124952-94124974 GAAGCACTCAGCACCACACCTGG + Intergenic
1100517013 12:95338112-95338134 CAGGCACCTGCTACCACGCCCGG + Intergenic
1101914168 12:108883549-108883571 AAAGTTCTTGGTACCACGCCTGG - Intronic
1101981685 12:109412926-109412948 CAAGCACTTGCCACTACGCCCGG + Intronic
1102050953 12:109861603-109861625 CAGGCACCTGCTACCACGCCCGG - Intronic
1102085433 12:110134141-110134163 CAGGCACTTGCCACCACGCCTGG + Intronic
1102582474 12:113899354-113899376 AAAGCACCTGGTATCACTCCTGG - Intronic
1102657157 12:114491705-114491727 GAAGCATTTGTTACCATACCAGG - Intergenic
1102672524 12:114632175-114632197 CAGGCACCTGCTACCACGCCTGG - Intergenic
1102682484 12:114699938-114699960 TAAACATTTGGTACCAGGCCAGG - Intergenic
1102876678 12:116454561-116454583 TAGGCACTTGCCACCACGCCTGG + Intergenic
1102949662 12:117022510-117022532 CAAGCACGTGCTACCACACCAGG - Intronic
1103198299 12:119065590-119065612 CAGGCACTTGCCACCACGCCGGG - Intronic
1103350937 12:120283138-120283160 CAGGCACGTGCTACCACGCCCGG - Intergenic
1103596557 12:122027692-122027714 CAAGCACATGCCACCACGCCCGG - Intronic
1104004545 12:124882834-124882856 GAAGCACTTGCCACCGTGCCTGG - Intergenic
1104026637 12:125032313-125032335 CAAGCACTTGCCACCACGCCCGG - Intergenic
1104315896 12:127700878-127700900 CAAGCACCTGCCACCACGCCCGG - Intergenic
1104457956 12:128931142-128931164 CAGGCACGTGCTACCACGCCTGG + Intronic
1104686171 12:130786539-130786561 CAAGTACCTGGGACCACGCCAGG - Intergenic
1104692654 12:130838825-130838847 GAAGCCCTGGGGACCCCGCCCGG + Intronic
1104750918 12:131237800-131237822 TAAGCACTTGCCACCATGCCTGG - Intergenic
1104869251 12:131982825-131982847 CAGGCACTTGCCACCACGCCTGG - Intronic
1105907635 13:24828949-24828971 TAGGCACTTGCCACCACGCCTGG + Intronic
1106306226 13:28513182-28513204 CAAGCACATGCTACCACACCAGG + Intergenic
1106311543 13:28558935-28558957 GAAGCACTTGGTTGCTGGCCTGG - Intergenic
1106544071 13:30715301-30715323 AAAGCACTTGGTCCCGTGCCTGG + Intronic
1106974845 13:35197643-35197665 GTAGCACCTGCCACCACGCCTGG + Intronic
1107844717 13:44499942-44499964 CAAGCACCTGCCACCACGCCTGG - Intronic
1107903304 13:45039664-45039686 CAGGCACCTGCTACCACGCCCGG - Intergenic
1107929739 13:45297303-45297325 CAAGCACCTGCCACCACGCCCGG - Intergenic
1108293416 13:48986536-48986558 GAAGCACGTGCCACCACACCCGG + Intronic
1108377809 13:49829475-49829497 CAGGCACATGTTACCACGCCCGG - Intergenic
1108407610 13:50121464-50121486 CAAGCACGTGCCACCACGCCTGG - Intronic
1108861657 13:54867896-54867918 GAGGCACATGCTACCATGCCTGG - Intergenic
1108899332 13:55380047-55380069 CAAGCACGTGCCACCACGCCTGG + Intergenic
1109197996 13:59400330-59400352 CAAGCACATGGCACCATGCCTGG - Intergenic
1109694605 13:65937453-65937475 TAAGCATTTGGAACCATGCCTGG - Intergenic
1110256858 13:73442696-73442718 CAGGCACCTGCTACCACGCCCGG - Intergenic
1110413455 13:75227705-75227727 CAGGCACTTGCCACCACGCCTGG + Intergenic
1110468074 13:75826181-75826203 CAAGCACATGCCACCACGCCTGG + Intronic
1110975070 13:81821330-81821352 TAAGCACGTGCTACCAAGCCTGG + Intergenic
1111625881 13:90786237-90786259 GAGGCACCTGCCACCACGCCCGG + Intergenic
1111946386 13:94669920-94669942 GAGGCACCTGCTACAACGCCCGG - Intergenic
1112114836 13:96340480-96340502 GAAGCACTTAGCAGAACGCCTGG + Intronic
1112446638 13:99470402-99470424 CAGGCACGTGCTACCACGCCTGG + Intergenic
1112711936 13:102139255-102139277 CAGGCACGTGCTACCACGCCTGG - Intronic
1113372925 13:109739074-109739096 CAGGCACATGGCACCACGCCTGG - Intergenic
1114277585 14:21161417-21161439 CAAGCACGTGCCACCACGCCTGG + Intergenic
1114421922 14:22590820-22590842 GAGGCACCTGCCACCACGCCCGG + Intergenic
1114542047 14:23468104-23468126 CAGGCACTTGCCACCACGCCCGG - Intergenic
1114864629 14:26574166-26574188 CAGGCACCTGTTACCACGCCTGG + Intronic
1114886543 14:26858910-26858932 CAAGCACGTGCAACCACGCCCGG + Intergenic
1115053994 14:29099978-29100000 GAAGCACTTGGAACAGTGCCTGG - Intergenic
1115216564 14:31019163-31019185 TAGGCACGTGCTACCACGCCTGG - Intronic
1115294771 14:31813127-31813149 CAGGCACTTGCCACCACGCCTGG + Intronic
1115614704 14:35083603-35083625 CAAGCACCTGCTACCATGCCCGG - Intronic
1115782315 14:36783372-36783394 GAAGCAGTTAGTACCATGCATGG + Intronic
1116883212 14:50192719-50192741 CAGGCACTTGCCACCACGCCTGG - Intronic
1117259782 14:54020131-54020153 CAGGCACGTGCTACCACGCCTGG + Intergenic
1117376365 14:55121681-55121703 CAGGCACTTGTTACCACGCCTGG + Intergenic
1117686556 14:58259455-58259477 CAAGCACCTGCCACCACGCCCGG + Intronic
1117772965 14:59152802-59152824 GAAGCACCTGCCACCACGCCTGG - Intergenic
1118185010 14:63529501-63529523 CAGGCACCTGCTACCACGCCCGG + Intronic
1118212641 14:63779766-63779788 CAGGCACGTGGCACCACGCCTGG - Intergenic
1118344921 14:64931389-64931411 CAAGCACTCGGCATCACGCCTGG - Intronic
1118638544 14:67770683-67770705 AAAGCACTTAGTATCATGCCTGG + Intronic
1119362265 14:74061118-74061140 CAGGCACCTGCTACCACGCCTGG + Intronic
1119549508 14:75498056-75498078 CAGGCACCTGCTACCACGCCCGG - Intergenic
1119583803 14:75812771-75812793 GAAGCACTTGTTACCAGGAATGG - Intronic
1119870227 14:78010819-78010841 GAAGCACTTGGAACAGTGCCTGG + Intergenic
1120485582 14:85109712-85109734 CAAGCACATGCCACCACGCCTGG - Intergenic
1120793418 14:88606603-88606625 GTAGCACGTGCCACCACGCCTGG - Intronic
1120980352 14:90283852-90283874 CAGGCACCTGCTACCACGCCCGG + Intronic
1121267110 14:92611401-92611423 GAGGCACCTGCTACCACTCCTGG + Intronic
1121451780 14:94012604-94012626 TAAGCACCTGCTACCATGCCTGG + Intergenic
1122212972 14:100184836-100184858 TAGGCACTTGCCACCACGCCTGG + Intergenic
1122896917 14:104762786-104762808 TAAGCACCTGCCACCACGCCTGG - Intronic
1122927953 14:104917755-104917777 GAAGCACCTGCCACCATGCCCGG + Intergenic
1123436214 15:20256425-20256447 CAGGCACTCGCTACCACGCCCGG - Intergenic
1123503260 15:20911718-20911740 GAGGCACCTGCCACCACGCCCGG + Intergenic
1123596746 15:21922679-21922701 GAGGCACCTGCCACCACGCCCGG + Intergenic
1124937721 15:34187994-34188016 CAGGCACTTGCTACCACACCTGG - Intronic
1125278614 15:38020499-38020521 GAAGCACTTGGTACCACCCAAGG + Intergenic
1125654916 15:41348219-41348241 CAGGCACTTGCCACCACGCCTGG + Intronic
1125915698 15:43485432-43485454 CAGGCACCTGCTACCACGCCTGG - Intronic
1125993511 15:44133431-44133453 CAAGCACCTGCCACCACGCCTGG - Intronic
1126006440 15:44262497-44262519 CAGGCGCTTGCTACCACGCCCGG - Intergenic
1126030682 15:44494771-44494793 TATGCACCTGCTACCACGCCCGG - Intronic
1126069269 15:44851507-44851529 CAAGCACGTGCCACCACGCCCGG - Intergenic
1126138067 15:45411640-45411662 TAAGCACGTGCTACCACACCTGG - Intronic
1126635714 15:50777865-50777887 CAAGCACCTGCCACCACGCCTGG + Intergenic
1127010218 15:54617556-54617578 GAAGCACTTAGCACAATGCCTGG + Intronic
1127029829 15:54849908-54849930 GAGGCACCTGCCACCACGCCTGG + Intergenic
1127103862 15:55592589-55592611 GAGGCACCTGCCACCACGCCTGG - Intergenic
1127416220 15:58759838-58759860 CAAGTACTTGCCACCACGCCCGG - Intergenic
1127811659 15:62570257-62570279 GACACACTTGGAACCAAGCCAGG - Intronic
1128038850 15:64551842-64551864 CAAGCACCTGCCACCACGCCTGG - Intronic
1128575169 15:68769244-68769266 CAGGCACTTGCCACCACGCCCGG - Intergenic
1129358062 15:75005865-75005887 CAAGCACGTGCTACCATGCCTGG + Intronic
1129474968 15:75778933-75778955 CAGGCACTTGCCACCACGCCTGG + Intergenic
1129548947 15:76427788-76427810 CAGGCACTTGGTACCACTCATGG - Intronic
1129657738 15:77535816-77535838 CAGGCACTTGCCACCACGCCTGG + Intergenic
1129997489 15:80019205-80019227 CAGGCACTTGCCACCACGCCCGG + Intergenic
1130239072 15:82168653-82168675 CAGGCACTTGCCACCACGCCCGG + Intronic
1130671427 15:85916260-85916282 CAAGCACTTGCCACCACTCCTGG - Intergenic
1130822387 15:87509131-87509153 CAGGCACCTGCTACCACGCCTGG - Intergenic
1131101971 15:89698998-89699020 CAAGCACATGCCACCACGCCTGG + Intronic
1131779992 15:95845859-95845881 GAAGCACTTGGTCCCCAGGCCGG + Intergenic
1131981613 15:97999942-97999964 CAGGCACCTGCTACCACGCCTGG - Intergenic
1132052982 15:98625837-98625859 CAGGCACGTGGCACCACGCCCGG - Intergenic
1132285709 15:100660606-100660628 CAAGCACATGCCACCACGCCTGG - Intergenic
1202968855 15_KI270727v1_random:212547-212569 GAGGCACCTGCCACCACGCCCGG + Intergenic
1132825860 16:1905030-1905052 CAGGCACGTGCTACCACGCCTGG - Intergenic
1133075427 16:3276793-3276815 CAGGCACTTGCCACCACGCCTGG + Intronic
1133159411 16:3900125-3900147 CAGGCGCGTGGTACCACGCCCGG - Intergenic
1133218306 16:4306847-4306869 GAAGCACTTGTCACCTCTCCAGG - Intergenic
1134003538 16:10801597-10801619 GAAGCACATGCTACCATGCCTGG + Intronic
1134104020 16:11472333-11472355 CAGGCACGTGGCACCACGCCTGG + Intronic
1134114852 16:11540305-11540327 CAAGCATGTGCTACCACGCCTGG + Intergenic
1134157991 16:11859646-11859668 CAGGCACATGCTACCACGCCTGG + Intergenic
1134280981 16:12816804-12816826 CAAGCACCTGCCACCACGCCTGG - Intergenic
1134284763 16:12851152-12851174 CAAGCACCTGCCACCACGCCCGG + Intergenic
1134340852 16:13344376-13344398 GCAGCACTTGGAACCATTCCTGG - Intergenic
1134410385 16:13999045-13999067 CAGGCACATGCTACCACGCCTGG - Intergenic
1134688765 16:16177240-16177262 GAAGCACTTAGCACAACCCCTGG + Intronic
1135044822 16:19146536-19146558 GAGGCACACGCTACCACGCCCGG - Intronic
1135433053 16:22403471-22403493 CAGGCACGTGCTACCACGCCTGG + Intronic
1135435489 16:22424399-22424421 GAAGCGCTTGGCACCATTCCGGG - Intronic
1135530201 16:23246494-23246516 GAGGCACTTGCCACCATGCCTGG - Intergenic
1136004060 16:27316225-27316247 GAGGCACCTGCTACCACGCCTGG - Intronic
1136098984 16:27979421-27979443 CAGGCACTTGCCACCACGCCAGG - Intronic
1136544006 16:30945518-30945540 AAAGCATTTGCCACCACGCCTGG - Intronic
1136562990 16:31052084-31052106 CAAGCACATGCCACCACGCCTGG + Intergenic
1136616057 16:31399279-31399301 AAAGCACTTGGAACCCTGCCTGG + Intronic
1137800548 16:51258644-51258666 TAAGCACTTGCCACCAAGCCCGG + Intergenic
1138395925 16:56704570-56704592 CAAGCACATGCCACCACGCCTGG - Intronic
1138459656 16:57140705-57140727 CAAGCACCTGCCACCACGCCGGG + Intronic
1139522789 16:67494493-67494515 CAAGCACATGCCACCACGCCCGG - Intergenic
1139622693 16:68159563-68159585 GAGGCACCTGCCACCACGCCCGG + Intronic
1140043928 16:71427083-71427105 GAGGTACTTGCCACCACGCCTGG - Intergenic
1140090224 16:71832017-71832039 CAGGCACTCGGTACCACACCTGG - Intergenic
1140190898 16:72815263-72815285 TAAGCACTTGCCACCACGCCTGG - Intronic
1140253167 16:73312631-73312653 GAAGCATTTGGCACCATTCCTGG - Intergenic
1140755249 16:78060704-78060726 CAAGCACCTGCCACCACGCCCGG + Intronic
1141553155 16:84819675-84819697 GAAGCGCTTGGCACCGCGCCAGG + Intergenic
1141872380 16:86796453-86796475 CAAGCACCTGCCACCACGCCCGG + Intergenic
1142044689 16:87918204-87918226 GAAGCACTTGGCACCATTCTGGG - Intronic
1142331919 16:89460414-89460436 CAGGCACCTGGCACCACGCCCGG - Intronic
1142558108 17:793344-793366 GTAGCACCTGCCACCACGCCTGG - Intergenic
1142719739 17:1768057-1768079 CAAGCACTTGCCACCACGCCTGG - Intronic
1142767536 17:2073799-2073821 CAAGCACGTGCCACCACGCCTGG - Intronic
1142789693 17:2254475-2254497 GAAGCACGTGCCACCAAGCCCGG + Intronic
1142847044 17:2686587-2686609 CAGGCACCTGCTACCACGCCTGG - Intergenic
1143073374 17:4317205-4317227 GAGGCACCCGCTACCACGCCTGG - Intronic
1143086767 17:4421865-4421887 CAGGCACTTGCCACCACGCCCGG - Intergenic
1143142642 17:4750554-4750576 CAGGCACCTGCTACCACGCCTGG - Intergenic
1144481265 17:15631109-15631131 GAATCACTTGGTAACTAGCCAGG + Intronic
1144697759 17:17316855-17316877 TAGGCACATGCTACCACGCCTGG + Intronic
1144747987 17:17628431-17628453 CAGGCACGTGCTACCACGCCTGG - Intergenic
1144752164 17:17656424-17656446 CAGGCACCTGGCACCACGCCTGG - Intergenic
1144826961 17:18110663-18110685 AAAGCATTTAGTACCAAGCCTGG + Intronic
1144917048 17:18732622-18732644 GAATCACTTGGTAACTAGCCAGG - Intronic
1145025733 17:19466611-19466633 CAGGCACGTGCTACCACGCCTGG - Intergenic
1145064728 17:19754566-19754588 CAAGCACCTGCCACCACGCCCGG + Intergenic
1145978918 17:29000105-29000127 AAAGCACTTCGTACAGCGCCTGG + Intronic
1146152309 17:30485407-30485429 CAAGCACATGCCACCACGCCTGG + Intronic
1146358879 17:32158600-32158622 CAAGCACATGCCACCACGCCCGG + Intronic
1146419846 17:32673244-32673266 CAAGCACGTGCTACCACACCTGG + Intronic
1146524401 17:33553687-33553709 AAAGCACATAGTACCATGCCTGG - Intronic
1146701418 17:34963807-34963829 AAAGCACTTAGAACCATGCCTGG - Intronic
1146898415 17:36563121-36563143 CAAGCACCTGCCACCACGCCTGG - Intronic
1146939411 17:36833909-36833931 CAGGCACTTGCCACCACGCCTGG - Intergenic
1147243033 17:39103070-39103092 GAGGCACCTGCCACCACGCCTGG - Intronic
1147639043 17:41982815-41982837 CAGGCACATGGTACCACGCCTGG - Intronic
1147734445 17:42626280-42626302 TAAGCACCTGCCACCACGCCTGG + Intergenic
1147886285 17:43686628-43686650 CAGGCACTTGCCACCACGCCCGG + Intergenic
1148032885 17:44634227-44634249 CAAGCACATGCTACCACACCTGG - Intergenic
1148235896 17:45968847-45968869 AAAGCACTTTGTACCATGCCTGG - Intronic
1148288029 17:46413744-46413766 CAAGCACTTGCCACCACACCCGG + Intergenic
1148310199 17:46631328-46631350 CAAGCACTTGCCACCACACCCGG + Intronic
1148929584 17:51117567-51117589 CAAGCACGTGCCACCACGCCTGG - Intronic
1149143703 17:53464626-53464648 CAGGCACTTGCCACCACGCCTGG + Intergenic
1149675686 17:58459502-58459524 CAGGCACCTGCTACCACGCCCGG - Intronic
1149725086 17:58885197-58885219 AAGGCACTTGCCACCACGCCTGG + Intronic
1149738874 17:59024069-59024091 GAGGCACATGCCACCACGCCCGG - Intronic
1149822599 17:59794061-59794083 CAAGCACCTGCCACCACGCCTGG + Intronic
1149972189 17:61229980-61230002 TAGGCACGTGCTACCACGCCCGG - Intronic
1150037713 17:61821670-61821692 TAGGCACATGCTACCACGCCTGG + Intronic
1150068107 17:62128533-62128555 CAAGCACATGCCACCACGCCCGG - Intergenic
1150311942 17:64135877-64135899 CAAGCACGTGCCACCACGCCCGG - Intergenic
1150356954 17:64495028-64495050 CAGGCACTTGCCACCACGCCTGG - Intronic
1150419988 17:65025037-65025059 CAGGCACTTGCTACCATGCCTGG + Intronic
1150822642 17:68447848-68447870 CAAGCACCTGCCACCACGCCCGG - Intronic
1151474325 17:74337172-74337194 CAAGCCCTTGGCACCATGCCTGG + Intronic
1151626608 17:75280226-75280248 TAGGCACTTGGTACCACACCTGG - Intronic
1151651241 17:75471092-75471114 CAGGCACTTGCCACCACGCCCGG - Intronic
1151765108 17:76129552-76129574 GAGGCACATGCCACCACGCCTGG - Intergenic
1151813121 17:76456764-76456786 GAAGTACCTGGTACAATGCCTGG - Intronic
1151989484 17:77565038-77565060 CAGGCACCTGATACCACGCCCGG - Intergenic
1153102904 18:1494819-1494841 GAAGCACCTGCCACCACGACGGG + Intergenic
1153203220 18:2668323-2668345 TAAGTACTTGGTACAATGCCTGG - Intronic
1153336232 18:3928556-3928578 GAAGCACTTGGAACCATGCCTGG - Intronic
1153342258 18:3987509-3987531 AAAGCACTTGGAACGATGCCTGG - Intronic
1153766920 18:8383889-8383911 GAGGCACTAGGTGCCACCCCAGG - Intronic
1153900233 18:9612169-9612191 GAAGCACTTGGAACAATTCCTGG - Intronic
1153962937 18:10154926-10154948 CAGGCACCTGGCACCACGCCCGG - Intergenic
1154228088 18:12526850-12526872 CAAGCACATGCCACCACGCCTGG + Intronic
1155037582 18:22038132-22038154 CAGGCACTTGCCACCACGCCTGG + Intergenic
1155039161 18:22050445-22050467 GAGGTACCTGCTACCACGCCCGG - Intergenic
1155266992 18:24104072-24104094 CAGGCACTTGCCACCACGCCCGG + Intronic
1155290642 18:24338213-24338235 CAAGCACTTGCCACCATGCCTGG + Intronic
1155294799 18:24375170-24375192 CAAGCACATGCCACCACGCCTGG - Intronic
1157033106 18:43937720-43937742 CAGGCACCTGCTACCACGCCCGG - Intergenic
1157548143 18:48562180-48562202 AAAGCACTTGGTACAGTGCCAGG - Intronic
1157656991 18:49400081-49400103 CAAGCACTTGCCACCACGCCTGG + Intronic
1157698498 18:49744261-49744283 GAGGCACGTGCCACCACGCCTGG - Intergenic
1158470252 18:57729691-57729713 CAGGCACTTGCCACCACGCCTGG + Intronic
1158481528 18:57825550-57825572 CAGGCACTTGCTACCACACCTGG - Intergenic
1159988361 18:74872612-74872634 GAAGCACGTACCACCACGCCTGG - Intronic
1160037755 18:75317197-75317219 GAAGCACTTGGGGCCAGGGCTGG - Intergenic
1160203097 18:76811229-76811251 AAAGCACTTGCCACCACGCCTGG + Intronic
1160484989 18:79282707-79282729 GAAGCGCTTGGTTCCAGACCTGG - Intronic
1160986636 19:1842066-1842088 CAGGCACCTGCTACCACGCCTGG - Intronic
1161040352 19:2107595-2107617 CAAGCACCTGCCACCACGCCCGG - Intronic
1161696915 19:5774108-5774130 CAAGCACCTGCCACCACGCCCGG + Intronic
1161867000 19:6840446-6840468 CAGGCACTTGCCACCACGCCTGG + Intronic
1161895906 19:7080159-7080181 CAAGCATTTGCCACCACGCCTGG - Intronic
1162037110 19:7946678-7946700 CAGGCACTTGCCACCACGCCCGG - Intergenic
1162354004 19:10169621-10169643 CAGGCACCTGCTACCACGCCAGG - Intronic
1162361874 19:10225364-10225386 CAAGCACATGCCACCACGCCTGG + Intronic
1162363678 19:10234815-10234837 CAGGCACCTGCTACCACGCCTGG - Intergenic
1162370900 19:10278682-10278704 CAGGCACCTGGCACCACGCCTGG + Intronic
1162375722 19:10304254-10304276 CAGGCACATGCTACCACGCCTGG + Intergenic
1162400113 19:10440739-10440761 CAGGCACATGGCACCACGCCCGG + Intronic
1162491864 19:10997339-10997361 CAGGCACCTGCTACCACGCCCGG + Intronic
1162595405 19:11625075-11625097 CAGGCACTTGCCACCACGCCCGG + Intergenic
1162766584 19:12923620-12923642 CAGGCACCTGCTACCACGCCAGG + Intronic
1162769917 19:12943225-12943247 CAGGCACTTGCCACCACGCCTGG + Intronic
1163333658 19:16657890-16657912 CAGGCACTTACTACCACGCCTGG - Intronic
1163376206 19:16932276-16932298 CAAGCACATGCCACCACGCCTGG - Intronic
1163425315 19:17237552-17237574 GAGGCACCTGCCACCACGCCTGG + Intronic
1163487751 19:17598810-17598832 CAAGCACTTGCCACCATGCCCGG + Intergenic
1163618538 19:18343823-18343845 CAGGCACCTGCTACCACGCCTGG + Intronic
1163853628 19:19682063-19682085 TAAGCACATGCCACCACGCCTGG + Exonic
1164584222 19:29456045-29456067 TAGGCACCTGCTACCACGCCTGG - Intergenic
1164627455 19:29738885-29738907 TAGGCACATGCTACCACGCCTGG - Intergenic
1164664661 19:30019676-30019698 TAGGCACCTGCTACCACGCCCGG + Intergenic
1164829659 19:31310814-31310836 AAAGCACTTAGCACCATGCCTGG + Intronic
1164913636 19:32032214-32032236 CAGGCACTTGCCACCACGCCTGG - Intergenic
1165103317 19:33453169-33453191 GAAGCACGTGCCACCATGCCTGG - Intronic
1165499665 19:36178317-36178339 CAGGCACCTGCTACCACGCCCGG - Intergenic
1165809260 19:38600946-38600968 TAGGCACGTGCTACCACGCCTGG + Intronic
1165919877 19:39289748-39289770 CAAGCACCTGCCACCACGCCTGG + Intergenic
1166068631 19:40375011-40375033 CAAGCACGTGCCACCACGCCCGG - Intronic
1166078478 19:40427879-40427901 CAAGAACATGCTACCACGCCTGG - Intergenic
1166132443 19:40754243-40754265 CAAGCACCTGCTACCACGCTTGG + Intronic
1166138897 19:40795024-40795046 CAGGCACTTGCCACCACGCCTGG - Intronic
1166160636 19:40950255-40950277 CAGGCATGTGGTACCACGCCTGG + Intergenic
1166554455 19:43688988-43689010 CAAGCACATGCTACCACACCAGG + Intergenic
1166710709 19:44935425-44935447 CAGGCACTTGCCACCACGCCTGG - Intergenic
1166888376 19:45974568-45974590 CAAGCATGTGCTACCACGCCTGG - Intergenic
1167020233 19:46869046-46869068 CAGGCACTTGCCACCACGCCTGG + Intergenic
1167098284 19:47387577-47387599 GACGCACATGCTACCACACCTGG + Intergenic
1167778190 19:51576290-51576312 CAGGCACTTGCCACCACGCCTGG + Intronic
1167973483 19:53204539-53204561 CAAGCGCTCGGCACCACGCCTGG - Intergenic
1168304568 19:55428586-55428608 GAAGCATTTGTTCCCAGGCCAGG - Intergenic
1168626202 19:57920137-57920159 CAGGCACTTGCTACCACGCCTGG - Intergenic
925750669 2:7088571-7088593 GAAGCAGTGAGTACCACGGCTGG + Intergenic
926023358 2:9516608-9516630 CAAGCACCTGTCACCACGCCTGG - Intronic
926078048 2:9958319-9958341 CAGGCACATGCTACCACGCCTGG + Intronic
926306106 2:11638281-11638303 CAGGCACATGCTACCACGCCTGG + Intronic
926622183 2:15056969-15056991 CAGGCACTTGCCACCACGCCCGG + Intergenic
926944432 2:18171403-18171425 GAAGCACTTGAAACAATGCCTGG + Intronic
927549751 2:23987633-23987655 CAGGCACTTGCCACCACGCCCGG - Intronic
927591642 2:24361966-24361988 CAGGCACTTGCCACCACGCCCGG + Intergenic
927740399 2:25564042-25564064 CAGGCACCTGCTACCACGCCCGG + Intronic
928191058 2:29168663-29168685 CAAGCACCTGCCACCACGCCCGG + Intronic
928515087 2:32037698-32037720 CAGGCACTTGCCACCACGCCTGG + Intronic
928523113 2:32110259-32110281 CAGGCACGTGGCACCACGCCAGG + Intronic
928803222 2:35119555-35119577 CAGGCACATGCTACCACGCCTGG - Intergenic
929218711 2:39441434-39441456 CAGGCACGTGGTACCACTCCCGG - Intergenic
929481361 2:42311408-42311430 AAAGCATGTGCTACCACGCCTGG - Intronic
929643869 2:43608249-43608271 GAAGCATGTGCCACCACGCCCGG - Intergenic
929952536 2:46426093-46426115 TAGGCACCTGCTACCACGCCTGG - Intergenic
930562484 2:52977887-52977909 CAAGCACCTGCCACCACGCCTGG + Intergenic
930607549 2:53508232-53508254 CAGGCACATGCTACCACGCCTGG - Intergenic
931830355 2:66044578-66044600 GAGGCACATGGCACCACACCTGG - Intergenic
931845725 2:66201894-66201916 GAGGCACGTGCTACCATGCCTGG + Intergenic
931878363 2:66539653-66539675 GAAGCATTTGGAACAGCGCCTGG + Intronic
932038804 2:68276777-68276799 CAGGCACCTGCTACCACGCCTGG - Intergenic
932355112 2:71061955-71061977 CAGGCACGTGCTACCACGCCTGG - Intergenic
932535947 2:72595116-72595138 CAAGCATTTGCCACCACGCCTGG - Intronic
932725447 2:74176131-74176153 CAGGCACTTGCCACCACGCCCGG - Intronic
932789734 2:74644393-74644415 CAAGCGCGTGCTACCACGCCCGG - Intronic
933143002 2:78816939-78816961 CAGGCGCTTGCTACCACGCCTGG + Intergenic
933626375 2:84605208-84605230 CAGGCACTTGCCACCACGCCTGG - Intronic
933721386 2:85399630-85399652 TAAGCACTTGCCACCATGCCTGG + Intronic
934086439 2:88513757-88513779 CAGGCACCTGCTACCACGCCCGG + Intergenic
934726244 2:96621543-96621565 CAGGCACATGCTACCACGCCTGG - Intronic
934741418 2:96725987-96726009 CAGGCACGTGCTACCACGCCTGG - Intronic
934759983 2:96849505-96849527 CAAGCACATGCCACCACGCCTGG - Intronic
934958728 2:98648355-98648377 CAGGCACTTGGCACCAGGCCTGG - Intronic
935001893 2:99026560-99026582 CAAGCACCTGCCACCACGCCTGG + Intronic
935033375 2:99344059-99344081 CAGGCACCTGCTACCACGCCTGG + Intronic
935615362 2:105074522-105074544 GAAGCACTTAGAACTATGCCTGG - Intronic
935849025 2:107198594-107198616 CAGGCACATGCTACCACGCCCGG - Intergenic
936100320 2:109572045-109572067 GAAGCATTTAGTACAATGCCTGG - Intronic
936248589 2:110849613-110849635 CAAGCACGTGCCACCACGCCTGG - Intronic
936737378 2:115462870-115462892 GAAGCACATGCCACCATGCCCGG + Intronic
937159012 2:119742505-119742527 GAAGCACATACTACCATGCCTGG + Intergenic
937622406 2:124003968-124003990 CAGGCACGTGCTACCACGCCTGG - Intergenic
938054659 2:128205261-128205283 CAAGCACGTGCCACCACGCCTGG + Intergenic
938269064 2:129953142-129953164 GAGGCACGTGCCACCACGCCTGG + Intergenic
938863207 2:135391720-135391742 CAAGCACCTGTCACCACGCCAGG + Intronic
939064872 2:137471060-137471082 CAGGCACTTGCCACCACGCCTGG + Intronic
939228607 2:139396398-139396420 CAAGCACATGCCACCACGCCTGG - Intergenic
939231495 2:139432014-139432036 GAAGCACGTGCCACCACACCTGG + Intergenic
939252488 2:139700080-139700102 CAGGCACTTGCCACCACGCCCGG + Intergenic
939751396 2:146051623-146051645 TAGGCACCTGCTACCACGCCTGG - Intergenic
939820112 2:146947129-146947151 AAAACACTTGGTTCCACTCCTGG - Intergenic
940060363 2:149559087-149559109 CAGGCACTTGCCACCACGCCCGG - Intergenic
940123722 2:150298293-150298315 CAAGTAGCTGGTACCACGCCTGG + Intergenic
941193746 2:162420231-162420253 GAGGCACATGCCACCACGCCTGG - Intronic
941466256 2:165831070-165831092 AAAGCACTTGGAACGACTCCTGG - Intergenic
941538781 2:166756690-166756712 CAGGCACATGCTACCACGCCCGG - Intergenic
941881991 2:170490169-170490191 CAAGCATCTGCTACCACGCCCGG + Intronic
942014961 2:171804399-171804421 AAAGCACCTGCCACCACGCCTGG + Intronic
942124163 2:172806492-172806514 AAAGCACTTAGTACAAAGCCTGG + Intronic
942571706 2:177322096-177322118 CAAGCGCCTGCTACCACGCCTGG - Intronic
942636931 2:178017815-178017837 CAGGCACCTGGCACCACGCCCGG - Intronic
942717305 2:178907854-178907876 CAAGCACGTGCTACCACACCTGG - Intronic
942751123 2:179288527-179288549 AAAGCACATGCCACCACGCCTGG - Intergenic
943001922 2:182338664-182338686 TAAGCACCTGACACCACGCCTGG + Intronic
943044939 2:182849082-182849104 CAGGCACTTGCCACCACGCCCGG - Intronic
943243599 2:185419247-185419269 CAGGCACTTGCTACCATGCCCGG + Intergenic
943590698 2:189792950-189792972 CAGGCACCTGTTACCACGCCTGG + Intronic
943980841 2:194548386-194548408 CAGGCACATGATACCACGCCAGG + Intergenic
944826187 2:203485266-203485288 CAAGCACATGCCACCACGCCTGG - Intronic
945169307 2:206979238-206979260 CAGGCACTTGCCACCACGCCCGG - Intergenic
945853099 2:215033796-215033818 CAGGCACCTGCTACCACGCCCGG - Intronic
946220239 2:218219490-218219512 CAAGCACGTGCTACCACACCTGG + Intronic
946287569 2:218716644-218716666 CAGGCACTTACTACCACGCCCGG - Intronic
946490210 2:220141761-220141783 CAGGCACCTGCTACCACGCCCGG + Intergenic
947040225 2:225910159-225910181 CAGGCACTTGCCACCACGCCTGG - Intergenic
947506231 2:230710499-230710521 CAGGCACATGCTACCACGCCTGG + Intergenic
947509210 2:230735307-230735329 CAGGCACTTGCCACCACGCCTGG + Intronic
948131356 2:235602842-235602864 CAAGCACTTGCCACCACGCCTGG + Intronic
948171819 2:235909876-235909898 CAGGCACCTGCTACCACGCCCGG - Intronic
948512406 2:238477512-238477534 CAGGCACATGCTACCACGCCTGG + Intergenic
948713495 2:239840925-239840947 CAGGCACCTGCTACCACGCCCGG + Intergenic
1168730433 20:73847-73869 CAGGCACGTGCTACCACGCCTGG - Intergenic
1168798774 20:630446-630468 CAAGCACCTGCCACCACGCCTGG - Intergenic
1169056006 20:2621524-2621546 TAGGCACTTGCCACCACGCCTGG - Intronic
1169158304 20:3353483-3353505 CAAGCACTTGCCACCACACCTGG - Intronic
1169391536 20:5195157-5195179 TAAGCATTTAGTACCATGCCTGG + Exonic
1169877096 20:10309938-10309960 GAAGCACTTAGCACAATGCCTGG - Intergenic
1169886888 20:10409826-10409848 CAAGCACCTGCCACCACGCCCGG - Intronic
1169931314 20:10836126-10836148 CAAGCACCTGCCACCACGCCTGG + Intergenic
1170671463 20:18438074-18438096 GAAGCACCTGCCACCATGCCTGG - Intronic
1170971246 20:21118564-21118586 GATGCACTTGGAATCATGCCTGG - Intergenic
1170986226 20:21261667-21261689 CAGGCACATGCTACCACGCCTGG + Intergenic
1171988326 20:31676238-31676260 GAAGCACTTAGCACCATGCCTGG - Intronic
1172557095 20:35851770-35851792 CAGGCACATGCTACCACGCCAGG - Intronic
1172591336 20:36120158-36120180 GAATCACTTATAACCACGCCTGG - Intronic
1172705613 20:36880234-36880256 CAAGCACTTGCCACCACGCCCGG + Intronic
1173297069 20:41769203-41769225 AAAGCACTTGGCTCCATGCCTGG + Intergenic
1173458970 20:43226561-43226583 GAAGCCCTTGGAACAAAGCCTGG - Intergenic
1173593510 20:44243497-44243519 CAGGCACATGCTACCACGCCTGG + Intergenic
1174129757 20:48334937-48334959 CAGGCACCTGCTACCACGCCTGG - Intergenic
1174207504 20:48851362-48851384 CAAGCACCTGCCACCACGCCTGG - Intergenic
1174472859 20:50773437-50773459 CAGGCACTTGCCACCACGCCTGG + Intergenic
1174487688 20:50871476-50871498 AAAGCACTTGCTGCCACCCCTGG + Intronic
1175166930 20:57050616-57050638 TAAGCACTTAGTACAAAGCCTGG + Intergenic
1176312655 21:5161384-5161406 AAAGCACTTAGTACCACTCCTGG + Intergenic
1176660669 21:9632462-9632484 CAAGCACCTGCCACCACGCCCGG + Intergenic
1176936036 21:14868145-14868167 CAGGCACTTGCCACCACGCCTGG - Intergenic
1177110912 21:17027223-17027245 GAAGCACTTGGAACCAGGCTTGG + Intergenic
1177485903 21:21755837-21755859 CAAGCACATGTCACCACGCCTGG + Intergenic
1177667306 21:24177222-24177244 CAGGCACTTGCTACCACACCCGG + Intergenic
1178535799 21:33409324-33409346 CAGGCACCTGCTACCACGCCTGG - Intronic
1178693384 21:34769473-34769495 TAAGCACATGCCACCACGCCTGG + Intergenic
1179135200 21:38673939-38673961 CAGGCACATGCTACCACGCCTGG + Intergenic
1179286853 21:39984940-39984962 AAAGCACTTGGTATGATGCCTGG - Intergenic
1179844393 21:44100646-44100668 AAAGCACTTAGTACCACTCCTGG - Intronic
1180138121 21:45874647-45874669 CAGGCACTTGCCACCACGCCCGG + Intronic
1180617318 22:17136897-17136919 GAGGCACATGCCACCACGCCTGG - Intergenic
1180705973 22:17810203-17810225 CAGGCACTTGCCACCACGCCTGG + Intronic
1180899105 22:19358140-19358162 CAGGCACATGCTACCACGCCTGG + Intronic
1181005524 22:20011598-20011620 GAAGAACTGGGGACCAAGCCAGG + Intronic
1181268702 22:21646094-21646116 CAAGCACCTGCCACCACGCCTGG + Intergenic
1181351061 22:22258138-22258160 CAGGCACTTGCCACCACGCCTGG - Intergenic
1181553962 22:23656825-23656847 CAAGCGCTTGCCACCACGCCAGG + Intergenic
1181836901 22:25617917-25617939 CAGGCACTTGCCACCACGCCTGG + Intronic
1181940122 22:26469316-26469338 CAAGCACTTGCTACCACACCTGG - Intronic
1182196735 22:28526897-28526919 CAAGCACTTGCCACCATGCCTGG + Intronic
1182470656 22:30546238-30546260 CAGGCACCTGCTACCACGCCTGG - Intronic
1182628541 22:31666513-31666535 CAAGCACTGGCCACCACGCCTGG + Intergenic
1182973642 22:34601567-34601589 CAAGCACGTGCCACCACGCCAGG + Intergenic
1183204837 22:36411642-36411664 AAAGCACTTGGCACAAAGCCAGG + Intergenic
1183340404 22:37277314-37277336 CAAGCACCTGCAACCACGCCTGG - Intergenic
1183366771 22:37411056-37411078 GAAGCACTTGGTGCTACGCCTGG - Intronic
1183522989 22:38307026-38307048 CAGGCACGTGCTACCACGCCTGG - Intronic
1183542126 22:38435548-38435570 CAGGCACTTGCCACCACGCCTGG - Intronic
1183547841 22:38464578-38464600 TAGGCACGTGCTACCACGCCTGG + Intergenic
1183644153 22:39113240-39113262 CAGGCACTTGCCACCACGCCTGG + Intergenic
1183707957 22:39486641-39486663 CAAGCACATGGCACCACACCTGG + Intronic
1183888976 22:40909620-40909642 CAAGCACGTGCCACCACGCCTGG - Intronic
1183980043 22:41533993-41534015 TAGGCACCTGGTACCACACCCGG - Intronic
1184083393 22:42242057-42242079 CAGGCACTTATTACCACGCCTGG - Intronic
1184184086 22:42852500-42852522 CAGGCACATGGCACCACGCCTGG + Intronic
1184231776 22:43162262-43162284 CAGGCACGTGCTACCACGCCTGG + Intronic
949489171 3:4571479-4571501 CAGGCACATGTTACCACGCCTGG + Intronic
950277926 3:11679538-11679560 CAGGCACATGCTACCACGCCTGG - Intronic
950784368 3:15421767-15421789 CAGGCACTTGCCACCACGCCTGG - Intronic
951645544 3:24886585-24886607 CAAGCACATGCCACCACGCCTGG + Intergenic
951973414 3:28474969-28474991 CAGGCACATGCTACCACGCCCGG + Intronic
952696317 3:36268727-36268749 CAAGCACATGCCACCACGCCCGG + Intergenic
952842762 3:37662258-37662280 GAGGCGCTTGCTGCCACGCCTGG - Intronic
953710475 3:45265533-45265555 GATGCTCTTGGGACCAGGCCTGG - Intergenic
954063789 3:48089738-48089760 CAGGCACTTGCCACCACGCCCGG - Intergenic
954208079 3:49075486-49075508 CAAGCATGTGCTACCACGCCCGG - Intronic
954210952 3:49096840-49096862 CAGGCACATGCTACCACGCCCGG - Intronic
954266466 3:49473723-49473745 CAGGCACTTGCCACCACGCCAGG + Intronic
954319318 3:49820621-49820643 CAGGCACTTGCTACCATGCCCGG - Intergenic
954530747 3:51317435-51317457 CAGGCACGTGGCACCACGCCTGG - Intronic
955096142 3:55800284-55800306 CAGGCACGTGCTACCACGCCCGG + Intronic
955568142 3:60271912-60271934 AAAGCACTTGGTACTACACCTGG - Intronic
955788816 3:62567471-62567493 GAATCACTTGGGAGCATGCCTGG - Intronic
956257956 3:67304501-67304523 TAGGCACTTGGCACCACACCTGG + Intergenic
956824132 3:72981863-72981885 CAAGCGCCTGCTACCACGCCTGG - Intronic
957049666 3:75401683-75401705 CAAGCACCTGCCACCACGCCCGG - Intergenic
957547377 3:81657011-81657033 CAGGCACCTGCTACCACGCCTGG - Intronic
957592266 3:82215001-82215023 CAGGCACTTGCCACCACGCCTGG + Intergenic
958109421 3:89121091-89121113 GAGGCACCTGCCACCACGCCTGG - Intronic
961230880 3:125307443-125307465 CAGGCGCTTGCTACCACGCCCGG + Intronic
961298638 3:125906982-125907004 TAGGCACCTGCTACCACGCCTGG - Intergenic
961594043 3:128002525-128002547 CAAGCACGTGCCACCACGCCCGG - Intergenic
961881984 3:130068122-130068144 CAAGCACCTGCCACCACGCCCGG - Intergenic
962099203 3:132324073-132324095 CAAGCACCTGCCACCACGCCTGG - Intronic
962231600 3:133670276-133670298 GAAGCACTTAGTACAATGCCTGG + Intergenic
962521218 3:136199164-136199186 AAGGCACGTGCTACCACGCCTGG - Intergenic
962568935 3:136692490-136692512 CAGGCATTTGCTACCACGCCTGG - Intronic
962818402 3:139022556-139022578 CAGGCACTTGCCACCACGCCTGG + Intronic
962958578 3:140289124-140289146 AAAGCCCTTGGAACCATGCCTGG - Intronic
963105126 3:141640470-141640492 GAAGCACATGCTATCATGCCCGG - Intergenic
963172141 3:142261832-142261854 CAGGCACCTGCTACCACGCCTGG - Intergenic
963544786 3:146642912-146642934 CAAGCACATGCCACCACGCCTGG - Intergenic
964014991 3:151934143-151934165 CAAGCACTTGCCACCACGCATGG - Intergenic
964084595 3:152800635-152800657 GAAGCCCTTGATACTATGCCAGG - Intergenic
964584881 3:158286425-158286447 AAAGCACTTGTTACCGTGCCTGG + Intronic
965225140 3:165979374-165979396 GAGGCACATGCTACCACACCCGG + Intergenic
965448685 3:168809280-168809302 CAGGCACCTGCTACCACGCCCGG + Intergenic
965603557 3:170478218-170478240 CAGGCACTTGCCACCACGCCTGG + Intronic
965641847 3:170837068-170837090 CAGGCACCTGCTACCACGCCTGG + Intronic
965711356 3:171559368-171559390 AAAGCACTTGGGACCCTGCCTGG + Intergenic
966523912 3:180900594-180900616 GAAGCCCGTGCCACCACGCCTGG - Intronic
966796809 3:183722793-183722815 GAGGCATGTGCTACCACGCCTGG + Intronic
966806759 3:183813851-183813873 CAGGCACCTGCTACCACGCCTGG - Intergenic
967038575 3:185667331-185667353 CAAGCACTTGCTACCGCACCTGG - Intronic
968173366 3:196528301-196528323 GAGGCATGTGCTACCACGCCCGG - Intergenic
968254518 3:197254911-197254933 CAAGCACGTGCCACCACGCCCGG - Intronic
968263907 3:197347584-197347606 CAAGCACGTGCCACCACGCCCGG - Intergenic
968791737 4:2669464-2669486 CAAGCACATGATAGCACGCCTGG - Intronic
968884361 4:3319585-3319607 CAGGCACTTGCTACCATGCCTGG + Intronic
969349220 4:6588570-6588592 CAGCCACTTGCTACCACGCCCGG - Intronic
969468589 4:7372447-7372469 CAGGCACCTGCTACCACGCCTGG + Intronic
969674565 4:8607740-8607762 GAAGCACTGGGGACCCCGCCAGG - Intronic
969994404 4:11296702-11296724 CAAGCACCTGCCACCACGCCTGG + Intergenic
970334868 4:15026367-15026389 GAAGCACATGCCACCACACCCGG + Intronic
970351745 4:15208388-15208410 TAAACACTTGGTACAATGCCTGG - Intergenic
970438667 4:16060454-16060476 CAGGCACGTGCTACCACGCCCGG + Intronic
970530737 4:16980003-16980025 CAGGCACCTGCTACCACGCCCGG - Intergenic
971087207 4:23292719-23292741 CAGGCACCTGCTACCACGCCTGG + Intergenic
971434330 4:26604293-26604315 CAGGCACTTGCCACCACGCCCGG + Intronic
971461921 4:26908624-26908646 CAGGCACATGCTACCACGCCCGG + Intronic
971738503 4:30489884-30489906 CAAGCATTTGCCACCACGCCTGG + Intergenic
971967598 4:33580255-33580277 CAAGCACATGCTACCATGCCTGG + Intergenic
972375464 4:38465457-38465479 CAAGCATGTGGCACCACGCCCGG - Intergenic
972771187 4:42198566-42198588 CAGGCACGTGCTACCACGCCTGG - Intergenic
973910350 4:55573606-55573628 CAGGCACATGCTACCACGCCCGG - Intronic
974252429 4:59404237-59404259 CAGGCACCTGCTACCACGCCCGG + Intergenic
975103811 4:70545871-70545893 CAGGCACATGGTACCACACCTGG - Intergenic
975125399 4:70776631-70776653 CAGGCGCCTGGTACCACGCCCGG - Intronic
975216989 4:71767500-71767522 GGAGCACTTGGTACCAGTCCTGG + Intronic
975599643 4:76085927-76085949 CAGGCACGTGGCACCACGCCTGG - Intronic
975653917 4:76621971-76621993 CAGGCACCTGCTACCACGCCTGG + Intronic
975782023 4:77849587-77849609 GAGGCACGTGCCACCACGCCTGG + Intergenic
975824856 4:78308728-78308750 AAAGCACTTGGAACCGTGCCTGG - Intronic
976133370 4:81908575-81908597 CAAGCACCTGCTACCATGCCTGG - Intronic
976240936 4:82956088-82956110 GTAGCACCTGCTACCACGCGCGG + Intronic
976579213 4:86715447-86715469 GAAGCATGTGCCACCACGCCTGG - Intronic
976720436 4:88164207-88164229 CAAGCACTTGCCACCATGCCTGG + Intronic
976959215 4:90946486-90946508 GAGGCGCCTGGAACCACGCCTGG - Intronic
978122394 4:105095556-105095578 CAAGCACTTGCCACCACACCTGG - Intergenic
978505122 4:109448575-109448597 CAGGCACTTGCCACCACGCCTGG + Intronic
978924673 4:114228807-114228829 CAGGCACATGCTACCACGCCCGG + Intergenic
979535548 4:121816096-121816118 CAAGCACATGCCACCACGCCTGG + Intronic
979634005 4:122936835-122936857 CAAGCACTTGCCACCACACCTGG - Intronic
979897696 4:126180293-126180315 CAGGCACATGCTACCACGCCTGG - Intergenic
981205499 4:142035081-142035103 GAAGCACTTGGCATCAAGCCTGG + Intronic
981956404 4:150479135-150479157 TAGGCACATGATACCACGCCTGG - Intronic
982006937 4:151072535-151072557 CAGGCACTTGCCACCACGCCTGG - Intergenic
982524598 4:156461982-156462004 CAGGCACGTGCTACCACGCCTGG + Intergenic
984217619 4:176933797-176933819 CAGGCACTTGCCACCACGCCCGG + Intergenic
984253828 4:177366539-177366561 CAAGCACCTGCCACCACGCCTGG + Intergenic
984293886 4:177829788-177829810 TAAGCACTTGCCACCACACCCGG + Intronic
984333665 4:178359578-178359600 TAAGCACATGCCACCACGCCTGG + Intergenic
985180963 4:187262075-187262097 CAGGCACCTGCTACCACGCCCGG + Intergenic
985645120 5:1081314-1081336 CAGGCACACGGTACCACGCCCGG - Intronic
985938201 5:3112779-3112801 CAAGCACGTGCCACCACGCCTGG + Intergenic
986235805 5:5909055-5909077 CAGGCACCTGCTACCACGCCCGG + Intergenic
986336715 5:6760832-6760854 GAAGCACCTGGAGCCATGCCAGG + Intergenic
986696863 5:10364944-10364966 CAAGCACATGCCACCACGCCCGG + Intronic
987358778 5:17087802-17087824 CAAGCACTTGCCACCATGCCTGG + Intronic
988521019 5:31945730-31945752 GAAGCACCTGGATCCAAGCCAGG - Intronic
988524687 5:31976858-31976880 CAGGCACGTGCTACCACGCCCGG + Intronic
988590377 5:32543769-32543791 CAGGCACTTGCTACCACACCTGG + Intronic
989095201 5:37775528-37775550 GAGGCACGTGCCACCACGCCTGG - Intergenic
989622754 5:43400938-43400960 CAAGCACCTGCCACCACGCCCGG - Intronic
989672748 5:43937330-43937352 GAAGCACTAGGGACCAATCCTGG + Intergenic
990102000 5:52202323-52202345 CAAGCACCTGCCACCACGCCTGG + Intergenic
990173316 5:53079792-53079814 AAAGCACTTGATACCATGGCTGG - Intronic
990253242 5:53938681-53938703 GAGGCACATGGCACCACACCCGG - Intronic
990407333 5:55504224-55504246 CAGGCACCTGGTACCACACCCGG - Intronic
990481351 5:56214380-56214402 AAAGTACCTGGCACCACGCCGGG - Intronic
990761346 5:59133430-59133452 GAAGCATTTGGCACAACACCTGG + Intronic
990764867 5:59171022-59171044 CAAGCACGTGCCACCACGCCTGG + Intronic
991124191 5:63051116-63051138 GAAGCACTTGGCACAATGCCAGG - Intergenic
991332176 5:65503797-65503819 CAAGCACGTGCCACCACGCCTGG + Intergenic
992253671 5:74900509-74900531 TAAGCACGTGCCACCACGCCTGG - Intergenic
992716590 5:79516575-79516597 CAGGCACTTGCCACCACGCCCGG + Intergenic
992863318 5:80933974-80933996 CAAGCACCTGCCACCACGCCTGG - Intergenic
993564654 5:89458267-89458289 GAAGCATTGGGTAGCATGCCAGG - Intergenic
994694396 5:103056478-103056500 TACGCACCTGCTACCACGCCTGG + Intergenic
995184407 5:109256549-109256571 GAAGCACTGGATACCACTCCAGG + Intergenic
995238775 5:109861535-109861557 AAAGCACTTGGCACAATGCCTGG - Intronic
995379729 5:111518484-111518506 CAGGCACCTGGAACCACGCCTGG + Intergenic
995969135 5:117946045-117946067 CAGACACTTGCTACCACGCCTGG + Intergenic
997104927 5:131007569-131007591 CAAGCACCTGCCACCACGCCCGG - Intergenic
997141089 5:131381463-131381485 AAGGCACCTGCTACCACGCCTGG + Intronic
997342246 5:133153845-133153867 CAGGCACCTGCTACCACGCCCGG + Intergenic
997494593 5:134311360-134311382 GAGGCACATGCCACCACGCCTGG - Intronic
997502653 5:134389092-134389114 TAGGCACATGCTACCACGCCTGG + Intronic
997525815 5:134552590-134552612 AAGGCACTTGGCACCAGGCCTGG + Intronic
997574174 5:134960907-134960929 CAAGCACGTGTCACCACGCCTGG + Intronic
998002298 5:138634807-138634829 CAGGCACTTGCTACCACACCTGG - Intronic
998826899 5:146111154-146111176 CAGGCACTTGCTACCACGCCCGG - Intergenic
999640492 5:153667575-153667597 TAAGCACTTAGTACCATGTCTGG - Intronic
999828905 5:155300300-155300322 CAGGCACCTGCTACCACGCCCGG - Intergenic
999914965 5:156248375-156248397 CAGGCACATGCTACCACGCCCGG - Intronic
999993478 5:157069786-157069808 AAAGCACTCGCTACCATGCCTGG + Intergenic
1000326915 5:160179276-160179298 CAGGCACATGCTACCACGCCCGG + Intergenic
1000914943 5:167070258-167070280 CAAGCACCTGCCACCACGCCCGG + Intergenic
1001383520 5:171319113-171319135 CAGGCACCTGCTACCACGCCTGG + Intergenic
1001393004 5:171395440-171395462 CAGGCACTTGCCACCACGCCTGG + Intronic
1001561275 5:172670435-172670457 AAAGCGCTTAGTGCCACGCCTGG - Intronic
1001977554 5:176012555-176012577 GAGGCACCTGCCACCACGCCCGG - Intronic
1001999682 5:176190762-176190784 CAGGCACCTGCTACCACGCCCGG - Intergenic
1002155796 5:177278248-177278270 CAAGCACTTGCCACCATGCCCGG + Intronic
1002394369 5:178941614-178941636 GCAGGACTCGGAACCACGCCAGG - Intronic
1002615745 5:180454668-180454690 CCAGCACTTGCCACCACGCCTGG - Intergenic
1003080943 6:3021098-3021120 CAGGCACATGCTACCACGCCTGG + Intergenic
1003118112 6:3296875-3296897 GAAGCCCTTGGTACCTGGACAGG - Intronic
1003596033 6:7474927-7474949 GAAGCATGTGCCACCACGCCTGG - Intergenic
1003627413 6:7754858-7754880 CAGGCACTTGCCACCACGCCCGG + Intronic
1003675920 6:8204195-8204217 CAGGCACTTGCCACCACGCCTGG + Intergenic
1003888973 6:10546514-10546536 CAAGCACCTGCCACCACGCCTGG - Intronic
1003931882 6:10931820-10931842 TAAGCATGTGCTACCACGCCTGG - Intronic
1004603688 6:17174554-17174576 CAAGCACGTGTCACCACGCCTGG - Intergenic
1004646375 6:17565458-17565480 AAGGCACGTGTTACCACGCCTGG + Intergenic
1004740733 6:18458078-18458100 CAGGCACTTGCCACCACGCCTGG + Intronic
1004877057 6:19966698-19966720 CAAGCACCTGCCACCACGCCTGG + Intergenic
1004978283 6:20992757-20992779 CAAGCACATGCCACCACGCCAGG - Intronic
1005077949 6:21926971-21926993 GAAGCACTTGCCACCATGCCTGG + Intergenic
1006079196 6:31555378-31555400 CAGGCACATGCTACCACGCCTGG + Intronic
1006267042 6:32934253-32934275 AAAGCACCTGGTACAATGCCTGG + Intergenic
1006694167 6:35916915-35916937 CAAGCACCTGCCACCACGCCCGG - Intronic
1006701667 6:35979331-35979353 CAAGCACCTGCCACCACGCCCGG - Intronic
1006723326 6:36175230-36175252 CAGGCACTTGCCACCACGCCTGG - Intergenic
1007286355 6:40750555-40750577 AAAGCACTTGATACAAGGCCTGG + Intergenic
1007546743 6:42700106-42700128 CAAAAACTTGGCACCACGCCTGG + Intronic
1007683783 6:43652566-43652588 CAGGCACCTGGCACCACGCCTGG + Intronic
1007727404 6:43924756-43924778 GAAGCACCTGGTAACAAGCCTGG + Intergenic
1007855258 6:44849044-44849066 GAAGCACTGGGTACCATACATGG + Intronic
1008010233 6:46459038-46459060 CAGGCACGTGCTACCACGCCCGG + Intronic
1008043181 6:46823467-46823489 CAGGCACGTGGCACCACGCCTGG - Intronic
1008684427 6:53909167-53909189 AAAGCCCTTGGCACCATGCCTGG - Intronic
1008933627 6:56966242-56966264 CAGGCACTTGCCACCACGCCTGG + Intronic
1009462086 6:63925784-63925806 TAGGCACGTGGCACCACGCCTGG + Intronic
1009769973 6:68133534-68133556 CAAGCACCTGCCACCACGCCCGG + Intergenic
1010018282 6:71129844-71129866 CAGGCACGTGCTACCACGCCTGG + Intergenic
1010207043 6:73332243-73332265 CAGGCACTTGCCACCACGCCTGG - Intergenic
1010368134 6:75076310-75076332 AAGGCACTTAGTACCATGCCAGG + Intergenic
1010431099 6:75779357-75779379 CAGGCACTTGCCACCACGCCTGG - Intronic
1010512121 6:76733046-76733068 GAAGCACTTAGTTGCATGCCTGG - Intergenic
1010612745 6:77974625-77974647 CAGGCACTTGCCACCACGCCTGG - Intergenic
1011202840 6:84856396-84856418 GAAGCATGTGGAACCACTCCAGG - Intergenic
1011603889 6:89083134-89083156 GAGGCGCGTGTTACCACGCCGGG + Intronic
1012951384 6:105521755-105521777 CAGGCACTTGCCACCACGCCTGG + Intergenic
1013259871 6:108431244-108431266 GAGGCACCTGCCACCACGCCCGG + Intronic
1013515995 6:110886446-110886468 TAAGCACCTGCCACCACGCCCGG + Intronic
1013530392 6:111014273-111014295 GAGGCACTTGCCACCACACCTGG + Intronic
1013992925 6:116275655-116275677 CAGGCACGTGCTACCACGCCCGG - Intronic
1014471147 6:121816248-121816270 CAAGCACGCGGCACCACGCCCGG - Intergenic
1014987953 6:128035221-128035243 CAGGCACTTGCTACAACGCCTGG - Intronic
1015998581 6:139019556-139019578 GAGGCACCTGCCACCACGCCTGG - Intergenic
1016022933 6:139254959-139254981 CAGGCACATGCTACCACGCCTGG + Intronic
1016465212 6:144318604-144318626 TAGGCACTTGCCACCACGCCTGG + Intronic
1016763668 6:147768353-147768375 CAGGCACATGCTACCACGCCCGG - Intergenic
1016767122 6:147807240-147807262 CAGGCACTTGCCACCACGCCTGG + Intergenic
1016974389 6:149792658-149792680 GAGGCACATGCTACCACACCTGG + Intronic
1017142454 6:151204195-151204217 CAGGCACCTGGCACCACGCCCGG + Intergenic
1017570229 6:155735983-155736005 CAAGCACCTGCCACCACGCCTGG - Intergenic
1017822481 6:158059695-158059717 CAGGCACTTGCCACCACGCCTGG + Intronic
1017911155 6:158794132-158794154 TGGGCACGTGGTACCACGCCCGG - Intronic
1018183251 6:161242923-161242945 GAGGCACGTGCCACCACGCCCGG - Intronic
1018194407 6:161342457-161342479 GAAGCACTTGGAAGCATGCCTGG - Intergenic
1018245848 6:161823075-161823097 GAAGCACATGCTACTATGCCAGG + Intronic
1018627987 6:165798848-165798870 CAAGCACGTGCCACCACGCCAGG + Intronic
1018769888 6:166961379-166961401 CAGGCACCTGGCACCACGCCTGG - Intergenic
1019337771 7:493449-493471 CAGGCACTTGCCACCACGCCGGG - Intergenic
1019341107 7:509431-509453 CAGGCACTTGCCACCACGCCTGG + Intronic
1019702778 7:2482069-2482091 CAGGCACGTGGTACCATGCCTGG + Intergenic
1020062299 7:5161397-5161419 CAGGCACCTGCTACCACGCCCGG - Intergenic
1020164787 7:5799390-5799412 CAGGCACCTGCTACCACGCCTGG + Intergenic
1020584283 7:10046628-10046650 CAGGCACTTGCCACCACGCCCGG + Intergenic
1020824092 7:13005491-13005513 CAAGCACCTGCCACCACGCCTGG + Intergenic
1021228724 7:18059633-18059655 AAAGCTCTTGGTACTATGCCTGG - Intergenic
1021487504 7:21183468-21183490 GAACTACTTGGTTCCACGCCTGG + Intergenic
1021509858 7:21424148-21424170 GAGGCACTTGCCACCACGGCTGG + Intergenic
1021602688 7:22379957-22379979 CAAGCACTTGCCACCATGCCTGG - Intergenic
1021880107 7:25086706-25086728 CAAGCACCTGCCACCACGCCCGG - Intergenic
1022239174 7:28492140-28492162 CAGGCACTTGCCACCACGCCTGG + Intronic
1022436757 7:30394283-30394305 CAGGCACGTGCTACCACGCCCGG + Intronic
1022733289 7:33052338-33052360 CAGGCACCTGCTACCACGCCTGG - Intronic
1023948464 7:44822303-44822325 CAAGCACATGCCACCACGCCCGG - Intronic
1024267360 7:47617014-47617036 CAGGCACTTGCCACCACGCCTGG - Intergenic
1024317346 7:48033909-48033931 CAGGCACGTGCTACCACGCCTGG - Intergenic
1024545895 7:50518066-50518088 CAGGCACTTGCCACCACGCCTGG - Intronic
1025119622 7:56289734-56289756 CAGGCACTCGCTACCACGCCCGG - Intergenic
1025843219 7:65171383-65171405 GAAGCACATGTCACCATGCCCGG + Intergenic
1025879825 7:65524588-65524610 GAAGCACATGTCACCATGCCCGG - Intergenic
1025893612 7:65678002-65678024 GAAGCACATGTCACCATGCCCGG + Intergenic
1025939229 7:66061921-66061943 GAGGCACCTGCCACCACGCCCGG - Intergenic
1025968224 7:66295772-66295794 TAGGCACATGCTACCACGCCTGG + Intronic
1025991860 7:66503251-66503273 GGAGCACATGGTGCCACCCCTGG - Intergenic
1026182561 7:68054950-68054972 CAAGCACTTGCCACCACACCCGG + Intergenic
1026229947 7:68473961-68473983 AAAGCACTTAGAACCACTCCTGG + Intergenic
1026257922 7:68728748-68728770 GAAGCACCCGGCACCATGCCTGG - Intergenic
1026308351 7:69162049-69162071 CAAGCACATGCTACCACGCCTGG + Intergenic
1026440482 7:70439394-70439416 CAGGCACGTGCTACCACGCCCGG - Intronic
1026638012 7:72101104-72101126 CAGGCACATGGTACCATGCCTGG + Intronic
1026648393 7:72193043-72193065 GAGGCATGTGGTACCACTCCCGG - Intronic
1026985087 7:74549891-74549913 CAGGCACCTGCTACCACGCCCGG - Intronic
1027183668 7:75956866-75956888 CAGGCACATGCTACCACGCCTGG + Intronic
1027190534 7:75993617-75993639 GAAGCAGTTGGAACCAGTCCAGG + Intronic
1029861384 7:103576086-103576108 CAAGCACGTGCCACCACGCCCGG - Intronic
1030167004 7:106565180-106565202 GAAGAACTTGGAAACAGGCCGGG - Intergenic
1030407271 7:109130097-109130119 CAGGCACTTGCCACCACGCCTGG + Intergenic
1030654359 7:112149966-112149988 GAAGCAGCTGGTACCTTGCCTGG - Intronic
1031047205 7:116904997-116905019 CAGGCACGTGCTACCACGCCCGG - Intronic
1031316929 7:120270133-120270155 CAAGCACCTGCCACCACGCCTGG - Intergenic
1031779621 7:125944975-125944997 CAAGCACATGCTACCATGCCTGG - Intergenic
1032079299 7:128850718-128850740 GAAGCACTCAGGACCAGGCCTGG + Intronic
1032160851 7:129509168-129509190 TAGGCACTTGCCACCACGCCTGG - Intronic
1032233793 7:130101825-130101847 CAAGCGCCTGCTACCACGCCCGG - Intronic
1032299325 7:130672031-130672053 CAGGCACTTGCCACCACGCCTGG + Intronic
1032549087 7:132767624-132767646 GAAGTACTTTGTACCACGTCTGG - Intergenic
1033059330 7:138090492-138090514 CAGGCACCTGCTACCACGCCTGG - Intronic
1033402531 7:141040326-141040348 CAGGCACTTGTCACCACGCCTGG + Intergenic
1033633984 7:143191740-143191762 CAGGCACCTGCTACCACGCCTGG + Intergenic
1033664479 7:143427755-143427777 CAAGCACATGCCACCACGCCTGG + Intergenic
1034117695 7:148599003-148599025 CAAGCACTTGCCACCACACCTGG + Intronic
1034629456 7:152519878-152519900 CAAGCACTTGCCATCACGCCCGG + Intergenic
1034646457 7:152652026-152652048 TAGGCACATGCTACCACGCCCGG - Intronic
1034846147 7:154447161-154447183 CAGGCACTTGCCACCACGCCTGG - Intronic
1035176534 7:157056036-157056058 CAGGCACATGATACCACGCCCGG - Intergenic
1035703559 8:1656178-1656200 GTAGCACGCGGTACCACGCCTGG - Intronic
1035825666 8:2642073-2642095 CAAGCACCTGCCACCACGCCTGG + Intergenic
1036747370 8:11419549-11419571 TAAGCACCTGCCACCACGCCTGG + Intronic
1036805177 8:11826670-11826692 CAAGCCCTTGCCACCACGCCCGG - Intronic
1037407498 8:18558676-18558698 CAGGCACGTGCTACCACGCCTGG - Intronic
1038250931 8:25903552-25903574 CAGGCACTTGCCACCACGCCTGG - Intronic
1038498210 8:28022299-28022321 TAGGCACATGCTACCACGCCTGG + Exonic
1038538578 8:28372642-28372664 CAGGCACATGCTACCACGCCTGG - Intronic
1038547760 8:28438955-28438977 CAGGCACTTGCCACCACGCCCGG - Intronic
1039589194 8:38732623-38732645 GAAGCACTTAGCACAATGCCTGG - Intronic
1040044727 8:42951201-42951223 CAAGCACATGCCACCACGCCTGG + Intronic
1040529787 8:48257431-48257453 CAAGCACCTGCCACCACGCCCGG + Intergenic
1041184319 8:55283247-55283269 AAAGCACTTAGCACCATGCCAGG - Intronic
1041935878 8:63331364-63331386 CAGGCACTTGCCACCACGCCTGG + Intergenic
1042082897 8:65075246-65075268 CAAGCATGTGCTACCACGCCCGG - Intergenic
1042141817 8:65686778-65686800 CAAGAACTTGCCACCACGCCCGG - Intronic
1042384739 8:68161235-68161257 CAGGCACTTGCCACCACGCCCGG + Intronic
1042540397 8:69902239-69902261 TAAGCACTTGCCACCACGCCTGG + Intergenic
1042597966 8:70469840-70469862 CAGGCACGTGGCACCACGCCCGG - Intergenic
1042648393 8:71012641-71012663 GAAGTACTTAGTACAATGCCTGG - Intergenic
1042835100 8:73072524-73072546 CAGGCACTTGCCACCACGCCCGG - Intronic
1042898154 8:73693330-73693352 CAGGCACCTGCTACCACGCCCGG - Intronic
1042915078 8:73867566-73867588 CAGGCACGTGCTACCACGCCTGG - Intronic
1043581853 8:81723537-81723559 CAAGCACGTGCCACCACGCCTGG - Intronic
1044418763 8:91967154-91967176 AAAGCACTTCATACCATGCCTGG + Intronic
1044426364 8:92055582-92055604 CAAGCACGTGCCACCACGCCTGG + Intronic
1044647363 8:94458722-94458744 CAGGCACTTGCTACCACGCCAGG - Intronic
1044867549 8:96587063-96587085 CAGGCACCTGCTACCACGCCTGG + Intronic
1045238496 8:100377282-100377304 CAAGCACTAGCTACCATGCCTGG + Intronic
1045313610 8:101025127-101025149 CAAGCACCTGCTACCACGCCCGG - Intergenic
1045505550 8:102775855-102775877 AAAGCACTTAGCACCATGCCTGG + Intergenic
1045808344 8:106191877-106191899 CAGGCACTTGGCACCACGCCCGG - Intergenic
1046029402 8:108765548-108765570 CAGGCACGTGGTACCACACCCGG + Intronic
1046984036 8:120367800-120367822 CAAGCACATGCCACCACGCCTGG - Intronic
1047985471 8:130228556-130228578 CAGGCACTTGCTACCATGCCTGG - Intronic
1048016168 8:130499588-130499610 AAAGCATTTGGAACCATGCCTGG - Intergenic
1048418373 8:134251867-134251889 CAAGCATGTGCTACCACGCCTGG - Intergenic
1048591823 8:135827455-135827477 GAAGCCCTGGGTACCACTTCTGG + Intergenic
1048929685 8:139302947-139302969 GTAGCACGTGGCACCACTCCTGG + Intergenic
1049064731 8:140304235-140304257 CAAGCACCTGCCACCACGCCCGG + Intronic
1051098847 9:13497932-13497954 CAGGCACTTGCTACCACACCTGG - Intergenic
1051295209 9:15588090-15588112 CAGGCACTTGCCACCACGCCTGG - Intronic
1051612690 9:18976938-18976960 GAAGCACTTAGCACAATGCCTGG + Intronic
1051643542 9:19245711-19245733 CAAGCACATGCCACCACGCCTGG - Intronic
1052152001 9:25128732-25128754 CAAGCACGTGCCACCACGCCCGG + Intergenic
1052515003 9:29469430-29469452 CAAGCACCTGCTACCACACCTGG + Intergenic
1052964674 9:34330628-34330650 AAAGCACTTGACACAACGCCTGG + Intronic
1052977315 9:34420835-34420857 CAAGCACATGCTACCACACCCGG - Intronic
1055306131 9:74930788-74930810 CAGGCACTTGCCACCACGCCCGG - Intergenic
1055642624 9:78332135-78332157 CAGGCACTTGCCACCACGCCTGG + Intergenic
1056337833 9:85593263-85593285 GAAGCACTTGTTAACACCACAGG + Intronic
1056389265 9:86125740-86125762 CAAGCACGTGGCACCATGCCCGG - Intergenic
1056459689 9:86797726-86797748 CAGGCACCTGGCACCACGCCTGG + Intergenic
1057344842 9:94240427-94240449 CAGGCACTTGCCACCACGCCTGG - Intergenic
1057666192 9:97047334-97047356 CAGGCACCTGGTACCACACCTGG + Intergenic
1057927271 9:99164516-99164538 CAAGCACGTGGTACCACACCTGG + Intergenic
1058054613 9:100436945-100436967 CAGGCACCTGCTACCACGCCTGG + Intronic
1058077291 9:100663857-100663879 CAGGCACGTGGGACCACGCCTGG + Intergenic
1058425663 9:104873756-104873778 GAAGCACTTAGTACAGTGCCTGG - Intronic
1058729060 9:107832471-107832493 GGAGCACTTGGTACAATGCCTGG + Intergenic
1058835855 9:108858063-108858085 CAGGCACCTGCTACCACGCCTGG + Intergenic
1058976774 9:110132194-110132216 GAGGCACCTGCCACCACGCCTGG + Intronic
1059089906 9:111345149-111345171 CAGGCACTTGCCACCACGCCCGG - Intergenic
1059179036 9:112194434-112194456 CAGGCACGTGTTACCACGCCTGG - Intergenic
1059229963 9:112711043-112711065 TAGGCACATGCTACCACGCCTGG - Intronic
1059397535 9:114047574-114047596 GAAGCACTGGATCCCAAGCCTGG - Intronic
1059584000 9:115585678-115585700 CAAGCACCTGCTGCCACGCCAGG + Intergenic
1060617554 9:125032332-125032354 CAAGCACACGATACCACGCCTGG + Intronic
1060684821 9:125599744-125599766 TAGGCACTTGCCACCACGCCCGG + Intronic
1060686379 9:125617316-125617338 TAGGCACTTGCCACCACGCCTGG - Intronic
1061097524 9:128467850-128467872 CAGGCACCTGCTACCACGCCCGG + Intronic
1061118026 9:128626955-128626977 CAAGCACGTGCCACCACGCCTGG + Intronic
1061353905 9:130088593-130088615 GAAGCACTTAGCACAATGCCTGG - Intronic
1061370851 9:130196594-130196616 CAGGCACCTGCTACCACGCCTGG - Intronic
1061534831 9:131241070-131241092 CAGGCACCTGCTACCACGCCTGG - Intergenic
1061697366 9:132387098-132387120 TAAGCACGTGGCACCATGCCCGG + Intronic
1061844352 9:133378592-133378614 GAAGTGCTTGGCACCATGCCAGG + Intronic
1061898203 9:133659409-133659431 GAAGCACTTGGTACCACGCCTGG - Intergenic
1062661451 9:137637038-137637060 CAGGCACCTGCTACCACGCCTGG + Intronic
1062684775 9:137806100-137806122 CAGGCACATGGCACCACGCCTGG + Intronic
1203449096 Un_GL000219v1:93542-93564 CAGGCACCTGCTACCACGCCTGG - Intergenic
1203638238 Un_KI270750v1:134306-134328 CAAGCACCTGCCACCACGCCCGG + Intergenic
1185542165 X:911221-911243 CAGGCACTTGCCACCACGCCTGG + Intergenic
1185566316 X:1098045-1098067 CAAGCACGTGCCACCACGCCTGG + Intergenic
1185653202 X:1663996-1664018 CAGGCACTTGCTACCACGCCCGG - Intergenic
1185696445 X:2198599-2198621 CAAGCACCTGCCACCACGCCTGG + Intergenic
1185760789 X:2688934-2688956 CAGGCACCTGCTACCACGCCTGG - Intergenic
1185803886 X:3039401-3039423 GAGGCACCTGCCACCACGCCCGG + Intergenic
1186004093 X:5049092-5049114 CAGGCACGTGCTACCACGCCCGG + Intergenic
1186157607 X:6741996-6742018 CAGGCACATGGCACCACGCCTGG + Intergenic
1186221930 X:7358325-7358347 GAAGCACTTAGAACCATGTCTGG - Intergenic
1186265521 X:7829123-7829145 CAGGCACATGCTACCACGCCAGG - Intergenic
1186534755 X:10335099-10335121 CAGGCACATGCTACCACGCCTGG - Intergenic
1186858879 X:13652026-13652048 CAAGCACGTGCCACCACGCCTGG + Intergenic
1187416461 X:19097366-19097388 CAGGCACCTGCTACCACGCCTGG - Intronic
1187710538 X:22049253-22049275 CAGGCACTTGCCACCACGCCTGG + Intronic
1187860289 X:23675983-23676005 CAGGCACCTGCTACCACGCCTGG - Intronic
1187915223 X:24147909-24147931 CAGGCACTTGCCACCACGCCTGG - Intergenic
1188372934 X:29391029-29391051 CAGGCACATGCTACCACGCCAGG - Intronic
1188431620 X:30109938-30109960 AAAGCACCTGAAACCACGCCTGG - Intergenic
1189282836 X:39831306-39831328 TAGGCACATGCTACCACGCCCGG + Intergenic
1189663887 X:43332568-43332590 CAAGCACCTGCTACCACACCTGG + Intergenic
1189714650 X:43853123-43853145 CAGGCACTTGCCACCACGCCTGG - Intronic
1189782409 X:44528837-44528859 CAGGCACTTGCCACCACGCCCGG + Intronic
1189980355 X:46504483-46504505 CAGGCACCTGCTACCACGCCTGG + Intronic
1190776084 X:53553283-53553305 CAGGCACCTGCTACCACGCCCGG + Intronic
1190840645 X:54140795-54140817 CAGGCACCTGCTACCACGCCTGG - Intronic
1191188826 X:57642539-57642561 CAAGCACTTGCCACCACCCCTGG - Intergenic
1191911283 X:66153070-66153092 CAGGCACCTGCTACCACGCCCGG - Intergenic
1192249567 X:69400326-69400348 CAGGCACCTGCTACCACGCCTGG + Intergenic
1192312543 X:70028622-70028644 GAAGCACTTGGTTCCCGGACAGG - Intronic
1192574713 X:72233966-72233988 CAGGCACCTGCTACCACGCCAGG - Intronic
1193117700 X:77791303-77791325 CAAGCACATGCCACCACGCCCGG - Intergenic
1193125777 X:77868675-77868697 CAGGCACTTGCCACCACGCCTGG - Intronic
1193152299 X:78138613-78138635 CAGGCACTTGCCACCACGCCCGG - Intronic
1193774477 X:85625047-85625069 CAGGCACCTGCTACCACGCCTGG + Intergenic
1193923161 X:87454331-87454353 GAGGCACCTGCCACCACGCCCGG + Intergenic
1194692270 X:97001501-97001523 CAGGCGCTTGCTACCACGCCTGG - Intronic
1194704906 X:97163330-97163352 CAAGCACATGGCACCACGCCTGG + Intronic
1194732647 X:97473815-97473837 CAGGAACCTGGTACCACGCCTGG - Intronic
1195047018 X:101063541-101063563 CAGGCACATGCTACCACGCCTGG + Intergenic
1196437341 X:115686760-115686782 TAAGCATGTGGCACCACGCCTGG - Intergenic
1196720636 X:118850467-118850489 CAGGCACCTGCTACCACGCCTGG + Intergenic
1196836032 X:119815006-119815028 CAGGCACCTGGCACCACGCCTGG + Intergenic
1197059154 X:122155949-122155971 CAGGCACTTGCCACCACGCCCGG - Intergenic
1197187854 X:123608256-123608278 CAAGCACGTGCCACCACGCCTGG - Intronic
1197509894 X:127358084-127358106 CAAGCACCTGCCACCACGCCTGG + Intergenic
1198086344 X:133286271-133286293 GAGGCACATGCCACCACGCCCGG + Intergenic
1198129511 X:133679795-133679817 GAGGCACATGCCACCACGCCCGG + Intronic
1198308253 X:135403705-135403727 GAAGCACTTGGTACCAATTTTGG + Intergenic
1199337803 X:146640816-146640838 GAGGCACTTGACACCATGCCTGG + Intergenic
1199711702 X:150474124-150474146 GAAGCACCAGGTCCCATGCCTGG - Intronic
1200022668 X:153225282-153225304 GAAGCTCTTGGTACCGTGCCTGG + Intergenic
1200399705 X:156012140-156012162 CAGGCACCTGCTACCACGCCTGG + Intergenic
1202039531 Y:20667615-20667637 GAGGCACATGCTACCATGCCTGG - Intergenic