ID: 1061899158

View in Genome Browser
Species Human (GRCh38)
Location 9:133664194-133664216
Sequence ATGTCCAACTCAAGATCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061899158_1061899164 -6 Left 1061899158 9:133664194-133664216 CCATGTGATCTTGAGTTGGACAT 0: 1
1: 0
2: 1
3: 10
4: 178
Right 1061899164 9:133664211-133664233 GGACATGGGCATCTGGGGTCCGG 0: 1
1: 0
2: 2
3: 35
4: 293
1061899158_1061899165 5 Left 1061899158 9:133664194-133664216 CCATGTGATCTTGAGTTGGACAT 0: 1
1: 0
2: 1
3: 10
4: 178
Right 1061899165 9:133664222-133664244 TCTGGGGTCCGGCAAAGCCAAGG No data
1061899158_1061899166 10 Left 1061899158 9:133664194-133664216 CCATGTGATCTTGAGTTGGACAT 0: 1
1: 0
2: 1
3: 10
4: 178
Right 1061899166 9:133664227-133664249 GGTCCGGCAAAGCCAAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061899158 Original CRISPR ATGTCCAACTCAAGATCACA TGG (reversed) Intronic
901183297 1:7356429-7356451 AGGTCTCACTCAAGATCACCTGG - Intronic
903146825 1:21378594-21378616 TTCTCCATCTCTAGATCACAAGG - Intergenic
903356616 1:22752022-22752044 ATGACCAACCCAAGGCCACACGG - Intronic
904128158 1:28257078-28257100 ATGTCAAAGTCCAGATCAAAAGG - Intergenic
912212545 1:107570823-107570845 ATGTCCAACTGCTGTTCACATGG + Intergenic
912216916 1:107625022-107625044 ATGACCTATTCAAGATCAGAAGG - Intronic
913380561 1:118205779-118205801 GTGGCCATCTCAACATCACAGGG + Intergenic
913561547 1:120025809-120025831 ATGGACAACTCAAGTTCACTAGG - Intronic
913599404 1:120408540-120408562 ATATACAACTGAAGATGACAAGG + Intergenic
913636579 1:120767792-120767814 ATGGACAACTCAAGTTCACTAGG + Intergenic
914087976 1:144471075-144471097 ATATACAACTGAAGATGACAAGG - Intergenic
914282133 1:146185223-146185245 ATGGACAACTCAAGTTCACTAGG - Intronic
914310635 1:146463129-146463151 ATATACAACTGAAGATGACAAGG + Intergenic
914419579 1:147517069-147517091 TTGCCCAAGTTAAGATCACATGG + Intergenic
914543161 1:148635930-148635952 ATGGACAACTCAAGTTCACTAGG - Intronic
914591470 1:149110016-149110038 ATATACAACTGAAGATGACAAGG - Intergenic
914623464 1:149435083-149435105 ATGGACAACTCAAGTTCACTAGG + Intergenic
916388215 1:164301176-164301198 CTGTCAAACTGAAGATCTCAAGG + Intergenic
917560461 1:176147770-176147792 AAGGCCAAATGAAGATCACACGG + Intronic
918571871 1:186004256-186004278 TTCTCCAACTCCAGATCTCAAGG + Intronic
919186821 1:194161718-194161740 ACGTCTAACTCAAGATCTGAAGG + Intergenic
923201201 1:231713224-231713246 ATGTTCAACAAAATATCACAAGG + Intronic
923478282 1:234358095-234358117 ATGACAGACTCAAGATCAAAAGG + Intergenic
924002737 1:239571753-239571775 ATGTCCAACTCCAAATGAAAGGG + Intronic
1062947189 10:1470509-1470531 ATGACTAACTCAAAATAACAAGG + Intronic
1064952156 10:20865028-20865050 AAGTCCAAGTAAGGATCACATGG + Intronic
1071914259 10:90273386-90273408 ATGTTCAACTCAATTTTACAAGG + Intergenic
1072376584 10:94822794-94822816 AAATCCAAATCAAAATCACAAGG - Intronic
1074503753 10:114048505-114048527 ATCTCCAACTGAAAATTACATGG + Intergenic
1074688575 10:115981870-115981892 ATGTCAACCCCAAGGTCACAGGG - Intergenic
1074984317 10:118643542-118643564 CTGTCCAAGCAAAGATCACAGGG + Intergenic
1075024269 10:118972393-118972415 ATGACCAACTCAAGAGAAAAGGG + Intergenic
1075410963 10:122227744-122227766 CTGACCAAGTCAATATCACAAGG - Intronic
1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG + Intergenic
1082065421 11:47895269-47895291 ATGTTCTTCTCAAGCTCACATGG + Intergenic
1082223592 11:49673106-49673128 AAATGCAACTCAAAATCACAGGG - Intergenic
1082556434 11:54568166-54568188 ATGGCCAACTCTAAATAACAAGG + Intergenic
1082768345 11:57186267-57186289 CTGTCCAACTCCAAATCACTGGG - Intronic
1088953716 11:114597450-114597472 AATTCCAACTGAATATCACAAGG - Intergenic
1089512691 11:119010279-119010301 AAGTCCAACAAAAGATCACATGG - Intronic
1090968357 11:131617911-131617933 CTGTCCATCTCAAGGTCAGACGG - Intronic
1094334664 12:29335380-29335402 ATCTCAAACTAAAGATCACCAGG - Exonic
1095309788 12:40685019-40685041 AAGTCCAACTCAGTATCACTGGG + Intergenic
1095994577 12:48069741-48069763 TTTTCCAACCCAAGATCAGAAGG + Intronic
1097690299 12:62728659-62728681 CTGTCTCACTCTAGATCACATGG + Intronic
1101425680 12:104586278-104586300 TTGTCCATCTCAAGAGCACCTGG - Intronic
1102389205 12:112536059-112536081 GTCTCAAACTCAAGATCACTGGG - Intergenic
1102539545 12:113608793-113608815 AGGGGCAATTCAAGATCACATGG - Intergenic
1102818749 12:115890192-115890214 ATGCTCAACTCAAGTTAACAGGG + Intergenic
1105258488 13:18761056-18761078 ATGTCCACATCCAGAGCACAGGG + Intergenic
1105261156 13:18780357-18780379 ATGTCCACATCCAGAGCACAGGG + Intergenic
1105263480 13:18796951-18796973 ATGTCCACATCCAGAGCACAGGG + Intergenic
1107257659 13:38447949-38447971 TTGTCTAACCCAAGGTCACAAGG + Intergenic
1111479333 13:88802498-88802520 ATGTTCTACTAAAGATCTCAAGG - Intergenic
1112588881 13:100745620-100745642 AAGTGCAAATCAAAATCACAAGG + Intergenic
1113177978 13:107588307-107588329 ATGTTCAATTCTACATCACATGG - Intronic
1116372652 14:44155160-44155182 ATGTACAACACAAGGCCACAAGG + Intergenic
1116866318 14:50034597-50034619 GTGTCCAACACAGGATCGCATGG + Intergenic
1121372501 14:93372862-93372884 ATGTTCTTCTCAAGGTCACAAGG + Intronic
1121483244 14:94294319-94294341 ATGTCCACCTCAAGTTCACGTGG - Intergenic
1202834958 14_GL000009v2_random:71089-71111 ATGTCCACATCCAGAGCACAGGG - Intergenic
1126056259 15:44732708-44732730 ATGTCAAAATAAAGATCATAAGG + Intronic
1127196194 15:56588489-56588511 AAGTCCAAATCAAAATCACCTGG - Intergenic
1127767534 15:62201943-62201965 TTGCCTAACTGAAGATCACAAGG - Intergenic
1128099169 15:64984160-64984182 ATGACTTACCCAAGATCACATGG + Intronic
1128481606 15:68045120-68045142 ATGTCTAACTCAATAACATAGGG + Intergenic
1133475656 16:6119065-6119087 ATGACCCACCCAAGATCCCATGG - Intronic
1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG + Intergenic
1139407520 16:66730808-66730830 CTGGCCAGCTCAACATCACAGGG + Intronic
1145003951 17:19326137-19326159 TTTTCCAAACCAAGATCACATGG - Intronic
1146413535 17:32610534-32610556 ATGAGTCACTCAAGATCACATGG - Intronic
1147860506 17:43519467-43519489 ATGTACAACTCAACAGCAAAAGG - Intronic
1152185696 17:78855218-78855240 ATGTCCCTCTCAAGATGAAAGGG + Exonic
1153014232 18:568911-568933 TTGTACAGCTCAAGTTCACATGG - Intergenic
1153100133 18:1458640-1458662 ATGTGCAAATTAAAATCACAAGG + Intergenic
1153968944 18:10207133-10207155 ATGGACAACTCGAGATTACAAGG + Intergenic
1154424869 18:14264450-14264472 ATGTCCACATCCAGAGCACAGGG - Intergenic
1154427557 18:14283783-14283805 ATGTCCACATCCAGAGCACAGGG - Intergenic
1154430283 18:14303323-14303345 ATGTCCACATCCAGAGCACAGGG - Intergenic
1154432556 18:14319673-14319695 ATGTCCACATCCAGAGCACAGGG - Intergenic
1202637745 1_KI270706v1_random:56603-56625 ATGTCCACATCCAGAGCACAGGG + Intergenic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
926317606 2:11722569-11722591 TTGTGCAGCCCAAGATCACAGGG + Intronic
926350028 2:11985684-11985706 ATGACCAGCACAAGGTCACAAGG - Intergenic
927879493 2:26680699-26680721 TTGTCCAACCCAAGAGCAAAAGG + Intergenic
929450234 2:42032075-42032097 ATGTGGCACTCAAAATCACATGG - Intergenic
930443704 2:51443375-51443397 ATTTGCAAGCCAAGATCACAGGG + Intergenic
932450804 2:71809553-71809575 ATGCCCAACTCAAGATAACATGG + Intergenic
935865428 2:107382381-107382403 ATTTCAAACTCAAAAGCACATGG + Intergenic
936047015 2:109196135-109196157 ACGTCCCACTCAGGGTCACATGG + Intronic
936724812 2:115300901-115300923 ATTTTCAACAAAAGATCACAAGG - Intronic
939201179 2:139036818-139036840 ATTTTCAAATCTAGATCACATGG - Intergenic
939892429 2:147753019-147753041 ATGTCTAGCTCAAGGACACAAGG - Intergenic
940267564 2:151855743-151855765 ATGTGCAAAGCAACATCACATGG + Intronic
942999808 2:182312369-182312391 TTGCCTAACTCAAGATCACAAGG + Intronic
943797092 2:192010183-192010205 ATGTTAAACTCAAAAACACATGG + Intronic
945909812 2:215635664-215635686 ATGTGCAACTCAAGAGTTCAAGG - Intergenic
945978202 2:216286988-216287010 ATGACTCACTCAAGGTCACACGG + Intronic
946140491 2:217686574-217686596 ATTTCCAAATCAAGATCTCAGGG + Intronic
946536783 2:220638824-220638846 ATGTCCAAATAAAGATGACAAGG + Intergenic
946693321 2:222326487-222326509 ATGCCAAACACAAGATCAAATGG + Intergenic
1168889693 20:1286922-1286944 ATGTCAGACTGAAGAACACATGG - Intronic
1170621453 20:17999838-17999860 ATGTCAAACTCAATATGCCATGG + Intronic
1174995920 20:55568133-55568155 AAGTCCAACTCAAAGTCAAAGGG + Intergenic
1176844485 21:13866075-13866097 ATGTCCACATCCAGAGCACAGGG + Intergenic
1176847209 21:13885638-13885660 ATGTCCACATCCAGAGCACAGGG + Intergenic
1179568300 21:42262756-42262778 ATGACCTGCTCAAGGTCACACGG - Intronic
1180213948 21:46313125-46313147 ATGGCCAACTCAAGAGCTGACGG - Intronic
1183741639 22:39671859-39671881 ATGACTTACTCAAGATCATAAGG + Intronic
1184193312 22:42909354-42909376 TTTTCCACCTCAAGACCACAAGG + Intronic
1184845038 22:47077557-47077579 ATGTGCAACTAAAGGTCACCGGG - Intronic
1184945376 22:47798984-47799006 ATATCCTTCTCAAGATCACATGG + Intergenic
1184953992 22:47869627-47869649 TTGCCCAACTCAAGGTTACAAGG - Intergenic
951133711 3:19078289-19078311 AGGTCTAACTCAAGGCCACAGGG + Intergenic
951235254 3:20227717-20227739 ATCTCCCACTCAACATCCCAGGG + Intergenic
956130638 3:66050445-66050467 ATATGCAAATCAAAATCACAAGG + Intergenic
957043906 3:75359726-75359748 ATGTCCCAAACAATATCACAGGG - Intergenic
957075706 3:75601911-75601933 ATGTCCCAAACAATATCACAGGG - Intergenic
957156905 3:76555481-76555503 ATTTTCAACTCAAGATGAGAGGG - Intronic
962960129 3:140303598-140303620 ATATCCAACTGAAGGTCACTTGG + Intronic
964248227 3:154679788-154679810 ATGTCCAAGTTAAGAAGACATGG + Intergenic
965039654 3:163490255-163490277 ATGTTCTCCTCAAGACCACATGG - Intergenic
965831458 3:172794164-172794186 TTGTCTAACCCAAGGTCACAAGG + Intronic
969700473 4:8765032-8765054 GTGCCCAACGCCAGATCACAGGG + Intergenic
971928511 4:33047447-33047469 AATTCCAATTCAACATCACATGG - Intergenic
972027775 4:34408241-34408263 ATGTTCCACTCAAGATCAAAAGG - Intergenic
973367980 4:49222968-49222990 ATGTCCACATCCAGAGCACAGGG + Intergenic
973805492 4:54522170-54522192 ATGTTCACCTGAAGATGACAGGG + Intergenic
978335745 4:107667027-107667049 AAGTCCAAGTCACCATCACAGGG + Intronic
981047829 4:140281672-140281694 ATCTCCAACTCAGGACCACCTGG + Intronic
982477809 4:155873983-155874005 ATCTCCAACTAAAGCTCAGAAGG - Intronic
983248649 4:165319582-165319604 ATGTTCAACACAAGATAAAAAGG - Intronic
984035349 4:174661278-174661300 ATATCTAACTCAACACCACAGGG + Intronic
984630559 4:182056024-182056046 AAGTACAATTCAATATCACAAGG - Intergenic
984683263 4:182635894-182635916 ATGTGCAACTCAGGGTCAGAAGG + Intronic
1202765066 4_GL000008v2_random:142460-142482 ATGTCCACATCCAGAGCACAGGG + Intergenic
987456226 5:18150459-18150481 ATGACCACTTCAAGATCTCACGG + Intergenic
987910882 5:24143261-24143283 ATATGCAACTAAAGATCAAAAGG - Intronic
988922716 5:35959267-35959289 ATTTTCAACAAAAGATCACAAGG + Intronic
992035043 5:72765052-72765074 AATTCAAACTCAGGATCACAGGG - Intergenic
992418553 5:76578050-76578072 AAGCCCAAATCAAGATGACAGGG - Intronic
993664771 5:90682167-90682189 ATGTCCAACTTAAGTTAGCAAGG + Intronic
994577897 5:101604346-101604368 AATTCCAACTCTGGATCACATGG - Intergenic
997460340 5:134047496-134047518 GTGTCCAACTCCAGACCCCAGGG + Intergenic
997622155 5:135305882-135305904 TTATCCAACCCGAGATCACAAGG + Intronic
999026472 5:148237911-148237933 ATGACCAACTAAAAATCCCAAGG + Intergenic
999165267 5:149544286-149544308 ATGACCCAGTCAATATCACATGG + Intronic
999839835 5:155413112-155413134 AGGTGGAACTCAAGATCAGAAGG + Intergenic
1000720782 5:164704000-164704022 TTGCCTAACACAAGATCACAAGG + Intergenic
1000890960 5:166801441-166801463 ATGTCCAACTCAACATCAATGGG + Intergenic
1001460836 5:171912489-171912511 ATGTCCACCACAATATAACAAGG + Intronic
1002205928 5:177562528-177562550 AGGTCCAACTCCAGAACTCAAGG - Intergenic
1004295362 6:14405199-14405221 ATGTCCAACTCAACACCAGATGG + Intergenic
1004433176 6:15564812-15564834 AAGTACAAATCAAAATCACATGG + Intronic
1006421526 6:33937034-33937056 ATGTCCTCCTCATGGTCACATGG - Intergenic
1008421657 6:51307870-51307892 CTGTCCAACTCCAGAGCTCATGG - Intergenic
1011067293 6:83341056-83341078 ATGCCCTACCCCAGATCACATGG - Intronic
1011432108 6:87298513-87298535 AAATCCAACTCTAAATCACATGG + Intronic
1015222715 6:130823095-130823117 TTGCCCAACCTAAGATCACAGGG - Intergenic
1015712858 6:136161160-136161182 ATGTCCAAATTTAGATCAAAAGG - Intronic
1017424766 6:154308904-154308926 ATCTGCAACTCAGGAACACAAGG + Intronic
1022619786 7:31971391-31971413 ATAACTCACTCAAGATCACATGG - Intronic
1027998322 7:85456485-85456507 ATTCCCAATTCAAGACCACATGG + Intergenic
1032055387 7:128680464-128680486 ATTTCCAATCCAAGCTCACAAGG + Intronic
1035088441 7:156282259-156282281 ATAGCCAACTCAGGATTACATGG - Intergenic
1038971005 8:32635499-32635521 TTGTCCAACTCAAAATGAAATGG - Intronic
1040537322 8:48321795-48321817 ATATCCAAGTCAAAATCATACGG - Intergenic
1041808599 8:61883104-61883126 ATGCCCAACTCTAGAGCTCAGGG + Intergenic
1042355586 8:67824145-67824167 ATGGGCAACAAAAGATCACAAGG + Intergenic
1045140545 8:99276883-99276905 CTGTCCAACTCAAGAACAAGTGG - Intronic
1045388388 8:101692163-101692185 ATTTCCAACTTAAGAACAGAAGG - Intronic
1045704517 8:104905850-104905872 TTGCCTATCTCAAGATCACATGG + Intronic
1046928116 8:119815020-119815042 ATCTCGAACTCATGATTACAAGG + Intronic
1046928117 8:119815047-119815069 ATCTCGAACTCATGATCACAAGG + Intronic
1047085154 8:121507671-121507693 ATGTCCCACTCAATCTCAGAGGG - Intergenic
1050882790 9:10724276-10724298 ATTTTCAACCAAAGATCACAAGG - Intergenic
1051839928 9:21384226-21384248 ATGTTGTACTCAAGATAACAAGG - Intergenic
1057690994 9:97285397-97285419 TTGTCTAACCCAAGGTCACAGGG + Intergenic
1059136610 9:111813243-111813265 ATGTCCAACACAAGAGGAAACGG - Intergenic
1060845618 9:126834899-126834921 ATGAACTACTCAAGTTCACAGGG - Exonic
1061899158 9:133664194-133664216 ATGTCCAACTCAAGATCACATGG - Intronic
1203545814 Un_KI270743v1:127349-127371 ATGTCCACATCCAGAGCACAGGG + Intergenic
1186308049 X:8286390-8286412 CTGTCCAACACAACATAACAGGG - Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1194277274 X:91900707-91900729 ATGTCCAACTTATGATTATATGG + Intronic
1194668863 X:96706201-96706223 GTGGCCAATTCAAGAGCACATGG - Intronic
1196410523 X:115413657-115413679 ATCTGCAACTCAACATCATATGG + Intergenic
1197291393 X:124662681-124662703 ATGTACTCCTCAAGATCACTAGG + Intronic
1200594617 Y:5122805-5122827 ATGTCCAACTTATGATTATATGG + Intronic
1201966848 Y:19746735-19746757 TTGTCTAACCCAAAATCACAAGG + Intergenic