ID: 1061900941

View in Genome Browser
Species Human (GRCh38)
Location 9:133671668-133671690
Sequence CCCCACAAAGGACAGCCGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061900933_1061900941 8 Left 1061900933 9:133671637-133671659 CCTTTGGAATGTGCAGCTCCCAG 0: 1
1: 0
2: 1
3: 24
4: 202
Right 1061900941 9:133671668-133671690 CCCCACAAAGGACAGCCGCATGG 0: 1
1: 0
2: 2
3: 10
4: 89
1061900934_1061900941 -10 Left 1061900934 9:133671655-133671677 CCCAGCCCAGCTCCCCCACAAAG 0: 1
1: 0
2: 2
3: 48
4: 444
Right 1061900941 9:133671668-133671690 CCCCACAAAGGACAGCCGCATGG 0: 1
1: 0
2: 2
3: 10
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061900941 Original CRISPR CCCCACAAAGGACAGCCGCA TGG Exonic
900124024 1:1061720-1061742 CCCCACAAAGGGCAGCTGCAGGG - Intergenic
900462587 1:2808729-2808751 CCCCAGAAAGCACAGCCTAATGG - Intergenic
900587343 1:3439680-3439702 CCTGACAAGGGACAGCCACAGGG + Intergenic
902923505 1:19680869-19680891 CCCCTCAGAGGCCAGCCGCCGGG - Intergenic
904615393 1:31746739-31746761 CCCCACAAAGGCCAGCCCCGTGG + Intronic
907384972 1:54120478-54120500 CTCCACAGAGCACAGCAGCAGGG + Intergenic
907951537 1:59188443-59188465 CCCAGCAAAGGAAAGCAGCAGGG + Intergenic
910807276 1:91201252-91201274 CCCCAGACAGGACAGCCTGATGG - Intergenic
912796289 1:112695535-112695557 CCCCAGCAGGGACATCCGCATGG + Exonic
918080850 1:181206733-181206755 CCCCACAATTGACACCCGCATGG + Intergenic
923834089 1:237590798-237590820 GCCCAAAAAGGCCAGCCCCAGGG - Exonic
924237024 1:242007612-242007634 CCCCACAGAGAACATCCACATGG - Intergenic
924466636 1:244304403-244304425 CTCCACAAGGGACATCCACAAGG - Intergenic
1062996645 10:1872539-1872561 CCCCACAAAGGGCAGCCCACTGG - Intergenic
1064326288 10:14354473-14354495 CCCCACATAGGTCAGCCTCTGGG - Intronic
1072473278 10:95734020-95734042 CGTCAGAAAGGACAGCTGCATGG + Intronic
1073740970 10:106406465-106406487 GCCCAGAAAGGACAGCAGCTTGG + Intergenic
1077132189 11:978644-978666 CCACACAAAAGACAGCTGCCAGG - Intronic
1083850946 11:65366543-65366565 CACCACAAAGGAAAGGGGCAGGG + Intergenic
1084879150 11:72157789-72157811 CCCCACAAAGGACAGTAGCAGGG - Intergenic
1092934490 12:13347854-13347876 CCCCAGGAAAGACAGCCTCAGGG - Intergenic
1096034125 12:48449309-48449331 CCCCACAAAGGATGGCTTCATGG + Intergenic
1096242063 12:49964905-49964927 CCCCACAGAGGACAGACCCACGG - Intronic
1104985835 12:132596510-132596532 CCCCACCAAAGACAGGAGCAAGG - Intergenic
1113382277 13:109814579-109814601 CCACACACAGGACAGCCTCCAGG + Intergenic
1113457887 13:110461931-110461953 CCCCACACTGGACAGCTGGATGG + Intronic
1113460710 13:110480035-110480057 CTCCAGAAAGGCCAGCCCCAGGG + Intronic
1115542510 14:34435279-34435301 CCCCACAATGGAAACCAGCATGG + Exonic
1121651742 14:95563990-95564012 CCCCAGAAAGGACACCCGTGAGG + Intergenic
1126038114 15:44566291-44566313 CCCTACAGAGGACAGCCTCAAGG - Exonic
1126652991 15:50944894-50944916 CCCCAGAAAGGACAGTAGCCAGG - Intronic
1129756277 15:78101135-78101157 CCCCAGAAAGGACAGGCCCCAGG - Exonic
1133203581 16:4219379-4219401 TCCTACAAAGGACAGCCCCTTGG + Intronic
1134558043 16:15183238-15183260 CCCCAAAAATGACAGCAGCTGGG - Intergenic
1134918579 16:18094840-18094862 CCCCAAAAATGACAGCAGCTGGG - Intergenic
1137445790 16:48531442-48531464 CCCAAAAAATGACAGCTGCACGG + Intergenic
1137669447 16:50270936-50270958 CCCCACCAAGGACAGTAGCATGG + Intronic
1138214259 16:55189373-55189395 CCCCTCAAAGGCCAGCCCCCCGG + Intergenic
1140307102 16:73813352-73813374 CCCCATAGAGGACAGCGGCCAGG + Intergenic
1140565296 16:76035101-76035123 CCCCACAAAGGAAAGTCCTAAGG - Intergenic
1142154566 16:88527240-88527262 ACCCACCAAGGGCAGCAGCAGGG + Intronic
1142760721 17:2040527-2040549 CCTCACAAAGGAAAGGCCCAAGG - Exonic
1146269751 17:31477055-31477077 CCCCACAAAAGACAGAAGAAGGG - Intronic
1146931756 17:36782806-36782828 GCCCTCAAAGGACAGTCCCAAGG - Intergenic
1148196339 17:45716060-45716082 GCACACAAAGGCAAGCCGCATGG - Intergenic
1150594616 17:66593232-66593254 CCCCACCAAGGACTGCTACATGG - Intronic
1151167569 17:72218620-72218642 CCGCACACAGGACAGACACATGG + Intergenic
1152209855 17:78997317-78997339 CCCCACAAAGGACACCGGCTGGG - Exonic
1154340808 18:13500563-13500585 CTTCACAAAGGACCGCCGAAAGG - Intronic
1156730147 18:40183942-40183964 CCCCACCAAGGACAAACCCAGGG - Intergenic
1157425632 18:47582181-47582203 TCCCACAAAGGCCTGCCCCAGGG + Intergenic
1158416551 18:57253942-57253964 CTCCCTAAAGGACAGCCCCAGGG - Intergenic
1164865949 19:31604680-31604702 CCCCACACTGGACAGCATCATGG - Intergenic
1165769013 19:38367708-38367730 GCCCACACTGGACAGCCTCAAGG + Exonic
1167190606 19:47986388-47986410 CCCCAGACAGGAGAGCCGCGTGG + Intronic
925149451 2:1605261-1605283 CCCCACACAGGACAGCAGGTGGG + Intergenic
925841475 2:7995984-7996006 CTCCACCCAGGACAGCCCCACGG + Intergenic
926738386 2:16091379-16091401 CCCCACCAAGGTGAGCCGCAGGG + Intergenic
937092382 2:119215012-119215034 CACAACACAGGACAGCCCCAGGG - Intergenic
947924110 2:233905881-233905903 CCCCAAAAGGGACAGCAACATGG - Intergenic
1168821255 20:775102-775124 CTCCACCAAGGTCAGCCCCATGG - Intergenic
1173620084 20:44429963-44429985 CATCCCAAAGGACAGCCGCCTGG + Exonic
1174842268 20:53911582-53911604 CCCTACAAAGGCCACCTGCAAGG - Intergenic
1179471562 21:41613984-41614006 CCCCACAGAGGACAGCGGAAAGG + Intergenic
1180226843 21:46398608-46398630 CCCGAGAAAGGACGGCGGCATGG - Intronic
1181638549 22:24185342-24185364 CCCCACTGAGGACAGCACCAGGG + Intronic
1184556548 22:45236300-45236322 CCCCACAAATCACACCTGCAGGG + Intronic
950107077 3:10395006-10395028 CCCCACAGAGGGCAGGGGCAGGG - Intronic
952977564 3:38709111-38709133 CCCCACAAAGGACTGAGTCAGGG - Intronic
958796720 3:98713922-98713944 GCCCACAAAGGAAAGCACCAGGG + Intergenic
960991452 3:123314265-123314287 CACCACCAAGGTCAGCAGCAGGG + Exonic
963412791 3:144953139-144953161 CCCCACAAAGGACAGCTTGCAGG + Intergenic
965491016 3:169336361-169336383 CACCACAAAGGACTACCTCATGG + Intronic
968056204 3:195693962-195693984 CCCCACAAAGGACTGACCCAGGG + Intergenic
970674765 4:18436332-18436354 CACCACAAAGAACAACAGCAGGG - Intergenic
985605495 5:855648-855670 CCCCACAGAGGACAGCCAGCCGG + Intronic
985776894 5:1849039-1849061 CCCCGCAAAGGAAAGTAGCAGGG + Intergenic
987729738 5:21753566-21753588 CCCCACAAAGGACATGAGAATGG + Intronic
991477829 5:67042284-67042306 CCCCACAAATAACAACAGCAAGG + Intronic
1001888624 5:175319385-175319407 CCACACCAAGGACAGCTCCAAGG + Intergenic
1005839567 6:29733243-29733265 CCACGCAAAGGACAGCTCCAGGG + Intronic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1011082891 6:83509046-83509068 TCCCAAATAGGACAGCCTCAAGG - Intergenic
1017638363 6:156465831-156465853 CCCCAGAAATGAGAGCTGCATGG - Intergenic
1019347999 7:539885-539907 CACCACACAGGGCAGCCGCCTGG - Intergenic
1020376285 7:7491108-7491130 GCTGAGAAAGGACAGCCGCAGGG - Intronic
1022941758 7:35248805-35248827 CCCCGAAAAGGACACCCGGATGG + Exonic
1035726891 8:1830287-1830309 GCCCACCAAGGACAGCCGCCTGG - Intronic
1036676603 8:10839424-10839446 CCCCACAAAGGGCGGCGGCGGGG + Intronic
1037754128 8:21700485-21700507 CCCCACAAAGGACTTTCCCACGG - Intronic
1042576565 8:70227110-70227132 GCCCACAAAGGGCTGCCTCATGG - Intronic
1042803578 8:72747126-72747148 CACCACAAAGGGAAGCCCCAGGG + Intronic
1045636559 8:104198447-104198469 CCACACAAAAGACAGAGGCAAGG + Intronic
1057551706 9:96055941-96055963 CACCACAGAGCACAGCCACAGGG + Intergenic
1061847340 9:133395101-133395123 CCCCAGAAAGGACAGACACCTGG + Intronic
1061900941 9:133671668-133671690 CCCCACAAAGGACAGCCGCATGG + Exonic
1062610776 9:137372497-137372519 ACCCACAAAGGACAGCCTACTGG + Intronic
1185584372 X:1234165-1234187 CCCCACAAAGGACAGCTCTGCGG - Intergenic
1186565000 X:10652910-10652932 CTCCACAAAGGAGAGGAGCAAGG - Intronic
1186837804 X:13455320-13455342 CAACACACAGGACAGCCCCACGG + Intergenic
1192790970 X:74381543-74381565 CCCCACAAAGGACAGCTTTGCGG - Intergenic
1200633972 Y:5626650-5626672 CCCAACAGAGGACAGTAGCAAGG - Intronic