ID: 1061902334

View in Genome Browser
Species Human (GRCh38)
Location 9:133679297-133679319
Sequence GAACTCAGCTGGTCTCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061902329_1061902334 28 Left 1061902329 9:133679246-133679268 CCTCAGCAAATCTGCACGGGTTC 0: 1
1: 0
2: 1
3: 7
4: 84
Right 1061902334 9:133679297-133679319 GAACTCAGCTGGTCTCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061902334 Original CRISPR GAACTCAGCTGGTCTCTGAC TGG Intronic
No off target data available for this crispr