ID: 1061904917

View in Genome Browser
Species Human (GRCh38)
Location 9:133691853-133691875
Sequence CCCAGGGCTCTGCGGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 367}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061904917 Original CRISPR CCCAGGGCTCTGCGGGTCCT GGG (reversed) Intronic
900118250 1:1037675-1037697 CACAGGGCTCTCAGGGTCCTAGG + Intronic
900205170 1:1428300-1428322 TCCAGGGCTCTGGGGCTCCCAGG + Intergenic
900342515 1:2195530-2195552 CTCAGGGCTCTGGGACTCCTTGG + Intronic
900645199 1:3705874-3705896 CCCTCGGCTCTGCAGGTCCTAGG - Intronic
901089219 1:6630232-6630254 CCCCGAGCTCTGAGGGTTCTTGG + Intronic
901466166 1:9422570-9422592 CCAAGGGTTCTGTGGGTCCCGGG - Intergenic
901669840 1:10849787-10849809 CCCTGGGCTCTGGGAGTCCCAGG - Intergenic
901672701 1:10865693-10865715 CCCAGGGCCCTCCGGGACCGCGG + Intergenic
902154798 1:14476471-14476493 CCCAGTGCTCTGCAGATCGTGGG + Intergenic
902203874 1:14853184-14853206 CCCAGGGATCTGCGGTTGCAGGG + Intronic
902731617 1:18373637-18373659 CCCAGGGCACCCCGGCTCCTGGG - Intronic
902796537 1:18804129-18804151 CTCTGTGCTCTGCGGGTCCCTGG + Intergenic
903121876 1:21221503-21221525 CCCAGGGCCCTTCTGGTTCTAGG - Intronic
903555099 1:24187350-24187372 CCCGCGGCTCTGCGGGCCATTGG - Intronic
903575471 1:24337164-24337186 CCCAGGTGTCTGAGGGTCCAGGG - Intronic
904713733 1:32450971-32450993 CCCAGGACTTTGGGGGGCCTAGG - Intergenic
904775341 1:32902594-32902616 CCCTGGGCTCTTTCGGTCCTTGG + Intergenic
905580870 1:39081927-39081949 CCCAGCGCCCTGTCGGTCCTCGG + Intronic
905791909 1:40794213-40794235 CCCTGTGCTCTGCAGGTCTTGGG - Intronic
909253435 1:73387777-73387799 CCCAGGCCTTTGCTGGGCCTTGG + Intergenic
910760830 1:90729644-90729666 GCCGGGGCGCTACGGGTCCTCGG + Intergenic
911285826 1:95991139-95991161 CCCAACGCTTTGGGGGTCCTAGG + Intergenic
912558194 1:110531329-110531351 CCCAGGGCCCTGCAGCTGCTGGG + Intergenic
912742270 1:112211564-112211586 CCCTGTGATCTGCAGGTCCTTGG + Intergenic
913960263 1:143333851-143333873 GGCTGGGCACTGCGGGTCCTCGG - Intergenic
914054619 1:144159424-144159446 GGCTGGGCACTGCGGGTCCTCGG - Intergenic
914124527 1:144806937-144806959 GGCTGGGCACTGCGGGTCCTCGG + Intergenic
914430742 1:147618973-147618995 CCCAGGACTCTCCCGGTCCAGGG - Exonic
915073681 1:153292468-153292490 CCCAGGGCTGCGGGGGTGCTGGG - Intergenic
915517388 1:156421305-156421327 TCCGGGGCTCTGCAGGGCCTGGG - Intronic
919756164 1:201067391-201067413 TCCAGGACTCTAGGGGTCCTAGG + Intronic
921168690 1:212526352-212526374 CCCATGGCTCTGAGGCTGCTGGG - Intergenic
921175154 1:212586888-212586910 CCCAGGGCCCTGCAGGGACTTGG - Intronic
921574736 1:216821433-216821455 CCCAGGGCTTTGTGGGGCCAAGG + Intronic
922586326 1:226737240-226737262 CCCGGGGCTCCGGGGCTCCTCGG + Exonic
922799851 1:228360220-228360242 CCCAAGGCTGTGTGTGTCCTGGG - Intronic
922821416 1:228487939-228487961 CCCAGGGCTCAGGGGGACCGGGG - Intronic
923290712 1:232542803-232542825 CACAGGGCTCAGCTGGGCCTTGG - Intronic
923511238 1:234655657-234655679 CCCAGGACTCTGCTGGTCAGGGG - Intergenic
923519518 1:234725075-234725097 CCCAGGGCTCCGTGGGACCCAGG - Intergenic
1066676907 10:37897313-37897335 CACATGGCTCGGAGGGTCCTGGG + Intergenic
1067028698 10:42866104-42866126 GGCCGGGCACTGCGGGTCCTCGG - Intergenic
1067045286 10:42981925-42981947 CCCATGGCTCAGTGGGGCCTGGG - Intergenic
1067119702 10:43463638-43463660 CCCAGAGCTCTGGGGGACCAAGG - Intronic
1067551026 10:47236647-47236669 CCCAGTGCCCTGAGGGTTCTGGG - Intergenic
1067944753 10:50682722-50682744 CCATGGGCTCTGCGGGGGCTGGG + Intergenic
1068523677 10:58104931-58104953 TCTTGGGCTCTGCCGGTCCTGGG - Intergenic
1071355053 10:84785269-84785291 CCCTCAGCTCTGCTGGTCCTGGG + Intergenic
1071457234 10:85860272-85860294 CCCAGGGCTCTGGGTGACCTAGG + Intronic
1071482949 10:86078774-86078796 GCCAGGGGGCTGGGGGTCCTAGG - Intronic
1071879207 10:89876543-89876565 CCCAGAGCTCTGGGGGGCCAAGG + Intergenic
1073123289 10:101134696-101134718 TCCAGGGATCTGTGAGTCCTGGG + Intronic
1075066196 10:119290617-119290639 CCAAGGGCTGTGTGAGTCCTTGG - Intronic
1076046054 10:127295005-127295027 CCCAGGGCTTTGGGAGGCCTAGG + Intronic
1076164837 10:128273329-128273351 CCCAGAGCTCCACGGGGCCTCGG - Intergenic
1077021126 11:417585-417607 CCCAAGGCTCTGGGGCTCCGGGG - Intergenic
1080663394 11:34315263-34315285 ACCAGGGCACTGAGGTTCCTGGG + Intronic
1080855344 11:36106959-36106981 CCCTGGGCGCTGCTGGTCCAAGG + Intronic
1081401889 11:42653288-42653310 CCCAGCACTTTGGGGGTCCTAGG - Intergenic
1081723379 11:45306442-45306464 CCCAGGATCCTGGGGGTCCTGGG - Intergenic
1081973222 11:47214459-47214481 GCCAGGCCTCTGCGGGTCCGGGG - Intronic
1083620979 11:64049291-64049313 CCCAAGGCTTTGGGGATCCTGGG - Intronic
1083765663 11:64840324-64840346 CCCAGAGCCCTGCGGGACCGCGG - Intronic
1083779166 11:64909291-64909313 CCCAGTGCTCTTGGGGTCCAGGG + Exonic
1084536129 11:69758315-69758337 CCCAGGCAGCTGAGGGTCCTTGG + Intergenic
1084608878 11:70188087-70188109 ACCAGGGCCCGGTGGGTCCTGGG + Exonic
1085390995 11:76182113-76182135 CCCAGGGCTCTGCCTGTCTTCGG + Intergenic
1085506977 11:77066511-77066533 CCCTGGCCCTTGCGGGTCCTCGG + Intergenic
1085508566 11:77073872-77073894 CCCAGAGCTCTGGGTGGCCTAGG + Intronic
1085508635 11:77074220-77074242 GCCAGGGCTCTTCCAGTCCTGGG + Intronic
1086009687 11:82085656-82085678 CCCAGGCCTCTGATGGTCCCTGG + Intergenic
1088868902 11:113875273-113875295 CCAAGGGCTCTGCGGGGCTCGGG - Intronic
1089182371 11:116591897-116591919 CCCAGTGCTCTGAGTGTCCCAGG + Intergenic
1090435662 11:126684465-126684487 CTCAGGGCTCTGAGGGTGTTAGG + Intronic
1091197965 11:133747743-133747765 CCCAGGGATCTGCGTGTGATGGG - Intergenic
1091321848 11:134657375-134657397 CTCCGGGCTGGGCGGGTCCTGGG - Intergenic
1092207782 12:6626361-6626383 CCCTGGGCTCTGTAAGTCCTAGG + Intronic
1093207472 12:16267984-16268006 CCCTGGGCTCTGGGAGGCCTAGG - Intronic
1093714449 12:22365963-22365985 CCCAGGGCTCGGGGGGGCGTAGG - Intronic
1096472936 12:51890269-51890291 CTCAGGCCTCTGCCTGTCCTGGG + Intronic
1097156083 12:57013297-57013319 CCCAGAGCTCTGTGGGGCATTGG - Intronic
1100685796 12:96985199-96985221 CCGAGGGCTGAGCGTGTCCTAGG + Intergenic
1101708076 12:107239627-107239649 CCCAGGTGTCTGAGGGACCTTGG - Intergenic
1101898348 12:108772239-108772261 TCCTGGGCTCTGAGGGTCTTGGG - Intergenic
1103518191 12:121520923-121520945 CCCTGAGCTCTGCCGGTGCTCGG - Intronic
1103953938 12:124566625-124566647 CCCCGGGCTGTGCGGATACTTGG - Intronic
1103974053 12:124690480-124690502 CCCAGGGCTGTGGGGCTCCAGGG - Intergenic
1104622040 12:130321846-130321868 CCCAAGGCTCAGCCTGTCCTGGG - Intergenic
1104820039 12:131671901-131671923 CCCAGGGCTCAGGTGGTCATGGG - Intergenic
1105756205 13:23466550-23466572 GCCAGGCCTCTGCGGCTTCTCGG + Intergenic
1106881269 13:34133807-34133829 CCCAGCACTCTGGGGGTCCGAGG + Intergenic
1108454778 13:50602107-50602129 CCCAGGGCTTTGGGAGGCCTAGG - Intronic
1108608988 13:52065422-52065444 CACTGGGCTGTACGGGTCCTTGG + Exonic
1113851422 13:113420866-113420888 CCCGGGGGTGGGCGGGTCCTGGG - Intergenic
1113851543 13:113421168-113421190 CCCAGGGGTAGGCGTGTCCTGGG - Intergenic
1114007789 14:18332967-18332989 CCCAGGGCTCTGCTCTTCCTCGG - Intergenic
1114223061 14:20714192-20714214 CCTTGGCCTCTCCGGGTCCTGGG + Intergenic
1114632265 14:24166710-24166732 GCCTGGGCCCTGTGGGTCCTGGG + Exonic
1117285404 14:54282052-54282074 TCCGGGGCTCTGTGGTTCCTGGG - Intergenic
1118603542 14:67487122-67487144 CCTAGGGCTCAGCTGATCCTTGG + Exonic
1118749823 14:68797353-68797375 CCCAGGGCAATGCTGGACCTGGG - Intergenic
1119217078 14:72877127-72877149 CTCAGGGCTCTGAGGGCCTTGGG + Intronic
1119732501 14:76959724-76959746 CCCAGAGGTCTGCGGTTCCAGGG - Intergenic
1121314325 14:92952121-92952143 CCCAGGGCTCTGCAGAGCCGGGG - Intronic
1121440295 14:93944682-93944704 CCCAAGGCTCAGAGGGGCCTGGG - Intronic
1121661722 14:95640115-95640137 CCCAGCACTCTGCAGGGCCTGGG + Intergenic
1122284361 14:100642040-100642062 CACAGGGCGCTGCGGGGCCAAGG - Intergenic
1122692411 14:103537622-103537644 CCCAGGCCTCTGGGGCTCTTGGG - Intergenic
1122955253 14:105067356-105067378 CCCCGGGCTGTGCGGCACCTGGG + Intergenic
1123782824 15:23644804-23644826 CCCAGGGCCCTGGAGGTGCTCGG + Exonic
1124369908 15:29098767-29098789 CCCAGGGCTCTGCGGGCGGGAGG + Intronic
1125727868 15:41877267-41877289 CCCAACACTCTGAGGGTCCTGGG - Exonic
1125836448 15:42755943-42755965 CCCAGCGCTCTGGGGGGCCGAGG + Intronic
1127383154 15:58446751-58446773 GCCAGGCCTGTGTGGGTCCTGGG - Intronic
1127931528 15:63600411-63600433 CCCAGGACTCTGCTGGGCCGGGG + Intronic
1129035735 15:72647438-72647460 TCCAGAGCTCTCCTGGTCCTAGG + Intergenic
1129214149 15:74089778-74089800 TCCAGAGCTCTCCTGGTCCTAGG - Intergenic
1129270354 15:74416190-74416212 CCCTGGGCACTGCTGGCCCTGGG - Intronic
1129399860 15:75275591-75275613 TCCAGAGCTCTCCTGGTCCTAGG + Intronic
1129473034 15:75765713-75765735 TCCAGAGCTCTCCTGGTCCTAGG - Intergenic
1131092165 15:89631399-89631421 TCCAGCCCTCTGCGGGTGCTGGG - Intronic
1131167604 15:90153727-90153749 CCCAGCGCTCTGGGGGGCCAAGG - Intergenic
1132151923 15:99468011-99468033 CTCAGGGCTCTGCAGCTGCTGGG - Intergenic
1132178325 15:99733087-99733109 CCCAGGGCTCCACGGCTCCACGG + Intronic
1132325233 15:100963505-100963527 CCCAGGCCTGTGCTGGCCCTTGG + Intronic
1132352285 15:101147401-101147423 CACAGGGCTCTGCGGTGCCCAGG + Intergenic
1132381684 15:101370625-101370647 CTCAGGGCCCTGCGGGCCCCGGG + Intronic
1132609393 16:807681-807703 CCCAGGGCGTGGCGGGCCCTCGG + Intronic
1132883227 16:2171409-2171431 CCCAGGGCTCTCGGGGGCCGGGG + Intronic
1133037381 16:3041397-3041419 CCCAGGGCTCAGCGGGTGGATGG - Intergenic
1133050995 16:3117330-3117352 CCCAAGGGTCTGCGGGGCCTGGG - Intronic
1133125051 16:3641285-3641307 CCCAGAGCCCTGCGATTCCTGGG + Intronic
1133323648 16:4930432-4930454 CTCCGGGCTCTGCTGGTCCTGGG + Intronic
1134073209 16:11273305-11273327 CTCGGGGCTCTGCTGGGCCTCGG + Exonic
1134211256 16:12279501-12279523 CCCAGTGCTCTGCCCTTCCTTGG + Intronic
1134626608 16:15726975-15726997 GCCGGGGAGCTGCGGGTCCTGGG - Exonic
1134667427 16:16028864-16028886 CCCAGGTCTGTCCGGGTCCACGG + Intronic
1135192243 16:20364075-20364097 CCTAGCACTCAGCGGGTCCTGGG + Intronic
1135500504 16:22991811-22991833 ACCAGGGCACTGCATGTCCTTGG + Intergenic
1136145175 16:28312237-28312259 CCCCGGGGCCTGCGCGTCCTTGG - Intronic
1137287304 16:47027031-47027053 CCCAGGCCTCTGCTGGCCCCAGG - Intergenic
1138563330 16:57815266-57815288 CCCAAGGCTGTGGGGGTCCTGGG + Intronic
1138655373 16:58488262-58488284 CCCAAGCCTCTGCGGCACCTGGG + Intronic
1140480321 16:75258938-75258960 CCCAGGAATCTGCGTGGCCTGGG + Intronic
1141635526 16:85312064-85312086 CCCAGGGCTCTGGGGGTGCAAGG - Intergenic
1141873329 16:86804640-86804662 CCCAGTGCTTTGCAGATCCTGGG + Intergenic
1142100574 16:88268915-88268937 CCCAGGGCTCTATGTGTCCAAGG - Intergenic
1142134429 16:88445074-88445096 CTCAGTGCTCTGCTGCTCCTGGG - Intergenic
1142290198 16:89190568-89190590 CCCTGGGCTCTGAGGGTCAGAGG + Intronic
1143490227 17:7281758-7281780 CCCACTGCTCTCCGGGTCCTTGG + Exonic
1143582552 17:7835379-7835401 CCCAGGGCTCTTCCTGTCCCGGG - Intergenic
1143921164 17:10332050-10332072 CCCAGGGCTGTGGGGTTACTAGG + Intronic
1145033894 17:19526510-19526532 CCCAGCACTCTGCGGGGCCGAGG - Intronic
1145270473 17:21402037-21402059 CCCAGCGTGCTGCGCGTCCTCGG + Intronic
1145963825 17:28902969-28902991 TCCAGGGCGGTGCGGGGCCTGGG - Exonic
1146547068 17:33748976-33748998 CCCTGGGCTCAGGGGGCCCTCGG + Intronic
1146623393 17:34417719-34417741 CCCAGGCTTGTGGGGGTCCTAGG - Intergenic
1147237504 17:39068737-39068759 CCCAGGGATCTGCAGTTCCCAGG + Intronic
1147696808 17:42361228-42361250 CCCAGCACTCTGGGGGGCCTAGG + Intronic
1147785296 17:42974108-42974130 CCCAGCACTCTGCGGGGCCAGGG + Intronic
1147888337 17:43699458-43699480 CCCAGGGAGCTGCTGGTCCAAGG - Intergenic
1148437340 17:47694434-47694456 CCCAGGGCTCGGCCGGTTGTGGG + Intronic
1149375330 17:56038260-56038282 CCCTGTCCTCTGCAGGTCCTGGG + Intergenic
1151472531 17:74326942-74326964 CCCAGGGCTCTGTGGGGCCATGG - Intronic
1151582389 17:74987824-74987846 CCCCCGGCTCTGCGGGACCCCGG + Exonic
1151880209 17:76890110-76890132 CCCAGGACTCTGTGGGGCCTGGG - Intronic
1151904184 17:77036884-77036906 CCCAGTGCTGTGCGGGTGCGTGG + Intergenic
1151993665 17:77595092-77595114 CCTGGGGCTCTGCTGGTCCCTGG + Intergenic
1152613794 17:81328838-81328860 CCCAGGGCTACCCGGGTCCCCGG + Intronic
1152627159 17:81393148-81393170 CGGAGGGCTCCGCGGGTCCCCGG + Intergenic
1152642441 17:81454810-81454832 GCCAGGGCTCTGCTGCTACTGGG - Intronic
1152806105 17:82357125-82357147 CAGAGGGCTCTGCTGCTCCTCGG + Intergenic
1153741904 18:8138265-8138287 CCCAGGGCTCTGCATGCTCTTGG + Intronic
1154475039 18:14747677-14747699 CCCTGGGCTCTGCTCTTCCTTGG - Intronic
1154529674 18:15330996-15331018 CCCGGGGCTCTGCTCTTCCTCGG + Intergenic
1156111488 18:33732603-33732625 CCCAGGACTCTGGGAGGCCTAGG + Intronic
1157298788 18:46464792-46464814 CCCAGTGCTCTGCAGGCCATGGG + Intergenic
1157500154 18:48184776-48184798 CACAGGGCTCTGGTGGCCCTTGG + Intronic
1157503205 18:48205050-48205072 CCCAGGGCCCTGAGGATCCCTGG - Intronic
1158891023 18:61871752-61871774 CCAAGGGCTCTGCAGCTCCAAGG - Intronic
1159491339 18:69138997-69139019 CCCAGGACTCTGGGAGTCCCAGG - Intergenic
1160192048 18:76722607-76722629 CCCAGGGCTCTGCACTTCCGTGG - Intergenic
1160778643 19:868129-868151 TCCAGGGATCTGGGGGTCCTGGG + Exonic
1160873542 19:1287275-1287297 GCCGGGGCTTTGGGGGTCCTGGG + Intronic
1161028469 19:2047369-2047391 CCCAGGGCTCTGCAGGTGGGAGG - Intronic
1161400496 19:4064962-4064984 ACCGGGCCTCTGCGGGTTCTGGG - Intronic
1161473454 19:4472594-4472616 CCTGGGGGTCTGGGGGTCCTGGG + Intronic
1161473531 19:4472812-4472834 TCCCGGGGTCTGGGGGTCCTCGG + Intronic
1161473560 19:4472891-4472913 CCCCGGGGTCTGGGGGCCCTGGG + Intronic
1161592906 19:5136756-5136778 CCCAGGGCTCTGCCTCTGCTGGG - Intronic
1162125715 19:8498581-8498603 CCCAGGGCTGAGCGGGTGCCGGG + Exonic
1162630533 19:11923979-11924001 TCCAGGGCTCTGCAGCTTCTCGG - Intergenic
1162635449 19:11964219-11964241 TCCAGGGCTCTGCAGCTTCTCGG - Intronic
1162766499 19:12922990-12923012 CGCAGGGCCCTGTGGGTCATGGG - Intronic
1162828313 19:13268011-13268033 CCCAGCGCTCTGGGAGGCCTAGG - Intronic
1163002396 19:14376230-14376252 CCCAGGCTTGTGCGGGTGCTGGG + Intergenic
1163485044 19:17580522-17580544 CCCAGGGGTCTGGCGGTCATGGG - Intronic
1164208234 19:23075320-23075342 CCCTGTGATCTGCAGGTCCTGGG + Intronic
1164244141 19:23415943-23415965 CCCTGTGATCTGCAGGTCCTGGG - Intergenic
1164673181 19:30084714-30084736 CCCAGGGCTGTGGGCTTCCTTGG + Intergenic
1165008801 19:32828232-32828254 CTCAGGACTCTGCAGGTCCAAGG - Intronic
1165176003 19:33930327-33930349 CCCTGGCCTCTGCCAGTCCTTGG - Intergenic
1165536515 19:36451755-36451777 CCCAGCACTCTGCGGGGCCGAGG + Intronic
1165786445 19:38464634-38464656 CCCAGGACTCTGCTGGCTCTGGG + Exonic
1166406899 19:42527932-42527954 CCCAGGGCTCTTCATGTCCTGGG + Intronic
1166670115 19:44704478-44704500 CCCAGCACTCTGGGGGGCCTAGG + Intronic
1166979328 19:46623545-46623567 ACCAGGGCTCTCTGGGTCCACGG - Exonic
1167148904 19:47697955-47697977 CCCAGCGCTTTGCGGGGCCGAGG - Intronic
1167158358 19:47752694-47752716 CCCAGGGCTGTCTGGGTCATTGG - Intronic
1167781624 19:51602115-51602137 CCCAGTTCTCTGCTGGTTCTGGG + Intergenic
1202694100 1_KI270712v1_random:112102-112124 GGCTGGGCACTGCGGGTCCTCGG - Intergenic
925154806 2:1640780-1640802 CCCAGGGCTGTGCAGGTCTGGGG + Intronic
926170571 2:10550420-10550442 CCCAAGGCTCTCTGGGCCCTGGG + Intergenic
927019805 2:19004861-19004883 CCCCAGGCTCTGCGGGTCCTGGG + Intergenic
927818881 2:26244916-26244938 ACCAAGGCTCTGCGGGACCAAGG - Exonic
928462349 2:31486232-31486254 CCCAGGTCTCTAAGGCTCCTAGG + Intergenic
930021530 2:47004731-47004753 CCAAGGGCTGTGCGGGAGCTGGG - Intronic
930613908 2:53573692-53573714 CCCAGGGCTGAGCAGGTTCTGGG - Intronic
932467208 2:71931570-71931592 ACCTGGCCTCAGCGGGTCCTAGG - Intergenic
932731853 2:74227169-74227191 CCCAGGACCCAGCGGGCCCTCGG - Intronic
933721217 2:85398775-85398797 CCCTGGCCCCTGCAGGTCCTGGG - Exonic
933952460 2:87342473-87342495 GGCTGGGCACTGCGGGTCCTCGG + Intergenic
933979865 2:87540690-87540712 CCCAAGGCTCTGCTGGACCTCGG + Intergenic
934236700 2:90238810-90238832 GGCTGGGCACTGCGGGTCCTCGG + Intergenic
934322913 2:91983689-91983711 GCCAGGGCTCTCAGGGTCATTGG - Intergenic
935227126 2:101062208-101062230 CCCAGGGCTCTGCTTTTCCTGGG + Intronic
936059627 2:109285946-109285968 CCCTGGGTTCTGAGGGTCCATGG + Intronic
936093886 2:109517307-109517329 CCCCGGACTGTGCGGGGCCTGGG + Intergenic
936268678 2:111031752-111031774 CTCAGGGGTCTACGGGTCCCTGG + Intronic
936313955 2:111410101-111410123 CCCAAGGCTCTGCTGGACCTTGG - Intergenic
938292520 2:130157629-130157651 CCCAGGGCTGTGTGGGCGCTGGG - Intronic
938528767 2:132162436-132162458 CCCGGGGCTCTGCTCTTCCTCGG + Intronic
938762527 2:134438764-134438786 CCCAGGGCTGTATGGGTCCTGGG + Intronic
944376404 2:199048944-199048966 CCCAGCGCTCTGTGGGACCTTGG - Intergenic
944808700 2:203307493-203307515 CCCAGAGCTCTCCAGGTACTGGG + Intergenic
946222824 2:218243525-218243547 CCCAGCACTTTGCGGGGCCTAGG + Intronic
947617926 2:231570116-231570138 TCCAGGCCTCTGGGGGCCCTGGG + Intergenic
947711885 2:232321213-232321235 GCTAGTGCTCTGGGGGTCCTTGG - Intronic
948149401 2:235733080-235733102 ACCAGGGCTCTGCTCTTCCTGGG + Intronic
1169155909 20:3329407-3329429 CCCAGGACTCTGGGGGGCCGAGG - Intronic
1170358249 20:15516534-15516556 CCCAGGGCAGTGCGGGTGCTGGG + Intronic
1170613036 20:17929562-17929584 CCCTGGGCTCCGCGGCCCCTGGG + Intergenic
1170969895 20:21106015-21106037 CCCAGGGGTCTCCGAATCCTAGG + Intergenic
1172013267 20:31858615-31858637 GCCTGGGCTCTGCGGGTCTCAGG + Intronic
1172781224 20:37437928-37437950 CCACGGGCTCTGTGGGGCCTGGG + Intergenic
1172891816 20:38271127-38271149 GCCAGGGCTCTGGGGGGACTTGG + Intronic
1175203304 20:57292429-57292451 CCCAGGGCTCAGTGGGCCCCTGG + Intergenic
1175515464 20:59567223-59567245 CCCAGGGCAGTGTGGCTCCTTGG + Intergenic
1175733641 20:61370952-61370974 CCCAGAGCGCTGAGGCTCCTCGG - Intronic
1175851028 20:62093093-62093115 CCCAGGGCTCTGCTGGGCAGGGG - Intergenic
1175909090 20:62396120-62396142 ACCAGGGACCTGCGGGTGCTCGG + Intronic
1176042366 20:63072316-63072338 CCCAGGGGGCCGCGGGTCCGGGG + Intergenic
1176055365 20:63142858-63142880 CCTAAGGCACTGAGGGTCCTGGG + Intergenic
1176423500 21:6533794-6533816 CCCAGGGCTGAGCAGGTCCTGGG - Intergenic
1176767736 21:13037476-13037498 CCCGGGGCTCTGCTCTTCCTCGG - Intergenic
1179504867 21:41833692-41833714 CCTGGCGCTCTGCGGGTTCTAGG + Intronic
1179698994 21:43142110-43142132 CCCAGGGCTGAGCAGGTCCTGGG - Intergenic
1179707452 21:43190283-43190305 CACAAGTCTCTGTGGGTCCTAGG + Intergenic
1179891068 21:44335356-44335378 GCCAGGACTCTGGGGGTCCCAGG + Intronic
1180012399 21:45059402-45059424 CCCAGGCCTCTTCTGGACCTGGG + Intergenic
1180432295 22:15263777-15263799 CCCAGGGCTCTGCTCTTCCTCGG - Intergenic
1180514858 22:16131714-16131736 CCCGGGGCTCTGCTCTTCCTCGG - Intergenic
1180950646 22:19719053-19719075 CCCAAGGGTCTGCGGGGGCTGGG + Intronic
1181066752 22:20310325-20310347 CCCAGGCCTCCGAGGGTTCTAGG - Intergenic
1181482962 22:23212542-23212564 CACTGGGCTCTGTGGGGCCTGGG + Intronic
1181692375 22:24571067-24571089 CCCAGGGCTTTGCGAGTCCAAGG - Intronic
1182280275 22:29214405-29214427 CCCAGGCCTTTGCTGGTGCTGGG - Intronic
1182558358 22:31140998-31141020 CCCAGGGCTCCCCGCTTCCTAGG + Intergenic
1182713173 22:32335143-32335165 CCCAGGGCTCCCAGTGTCCTTGG - Intergenic
1183093973 22:35541260-35541282 CCGAGGGCTCGGCGGGGCCCGGG - Exonic
1183453658 22:37909954-37909976 CCCAGGGCTCTGCTGGGACGAGG + Intronic
1184195694 22:42926288-42926310 CCTAGAGCTCAGCAGGTCCTAGG + Intronic
1184279561 22:43429248-43429270 CCCAGTGCTGTGTGGCTCCTTGG + Intronic
1184381119 22:44145461-44145483 ACCTGGGCTCTGCGGCTCCCAGG + Intronic
1184716909 22:46287688-46287710 CCCAGGCCTCTGTGGTTCCAGGG - Intronic
1184825318 22:46946620-46946642 CCCACGGCTGTGCGGGCACTGGG + Intronic
1184841495 22:47054948-47054970 CCCAGGGCCATGCTGGACCTGGG - Intronic
1185245346 22:49770175-49770197 CCCAGGGCTCGGCGGCAGCTTGG + Intergenic
1185326713 22:50229173-50229195 CCCTGGGCTGTGTGGGCCCTGGG - Intronic
949893327 3:8749465-8749487 CCCAGGACTCTGCTGTTCCCAGG - Intronic
950570646 3:13797943-13797965 CCCAGCGCTTTGCGGGGCCGAGG + Intergenic
950881114 3:16323257-16323279 CCTTGGGCTCTGCGAGCCCTTGG + Intronic
953662921 3:44904040-44904062 CCCAGGGTTCTGTGGGTCTTGGG + Intronic
954337828 3:49929948-49929970 CCCACGGCTCTGCTGGGACTAGG - Exonic
954634868 3:52065880-52065902 CCCTGGGCTCAGCTGCTCCTAGG - Intergenic
955335077 3:58078738-58078760 CACAGGCTTCTGCGGGTCCCAGG - Exonic
956605056 3:71065245-71065267 GCCGGGGCTCTGCGGGGCCGGGG + Intronic
957665427 3:83218933-83218955 CCCTGTGCTCTCAGGGTCCTGGG - Intergenic
960914378 3:122681240-122681262 CCCGGGGCGCTGCGGTTCCCCGG + Intronic
961663901 3:128484763-128484785 GCCGGGGCTCAGCGGGTGCTGGG + Intronic
961767740 3:129225146-129225168 CCCAGTGCCCTGCTGGCCCTAGG - Intergenic
962751003 3:138434823-138434845 CCCAGGGCGCTGGGGGCCCCGGG - Exonic
962827747 3:139112239-139112261 CCAAGGCTTCTGTGGGTCCTGGG + Intronic
967919242 3:194602251-194602273 CCCAGGCCGCTGTGGCTCCTGGG + Intronic
967924028 3:194632816-194632838 CCCAGGGCTCGCGGTGTCCTCGG + Intronic
968311399 3:197686504-197686526 CACGCAGCTCTGCGGGTCCTGGG + Intronic
968464561 4:744103-744125 CCCACGGCTTTGCGGGTCCCAGG + Intronic
968517661 4:1021670-1021692 CCCAGGGCCCAGCCGGGCCTGGG - Intronic
968572110 4:1347281-1347303 CCCGGGGCTCTGCGGGCGCCGGG + Intronic
968614139 4:1569760-1569782 GCCGGGGGTCTGGGGGTCCTTGG - Intergenic
968635102 4:1674186-1674208 CCAGGGGCTCTGGGAGTCCTCGG + Intronic
968657191 4:1783703-1783725 CCCAGGCCTCTGTGGGGCCAGGG + Intergenic
969369085 4:6719927-6719949 CCCAGGGCTTTGGGAGGCCTAGG + Intergenic
969704855 4:8786142-8786164 CCCAGGGCTCTGCTGGTTTCAGG - Intergenic
969728690 4:8940517-8940539 CCCAGGGCCCTGGGAGTTCTCGG + Intergenic
969891586 4:10264862-10264884 CCCTGTGATCTGCAGGTCCTGGG - Intergenic
970168476 4:13264707-13264729 CCCAGGGCTCTACCAGTCTTTGG - Intergenic
970913561 4:21307070-21307092 CCCAGGACTTTGGGGGTCCAAGG - Intronic
971495565 4:27260693-27260715 CACTGGGCTCTGCTGGTTCTTGG - Intergenic
972253232 4:37327511-37327533 CCCAGTTCTCTACGGGTACTGGG + Intronic
973795808 4:54425189-54425211 GCCAGGTCCCTGCAGGTCCTGGG - Intergenic
981483869 4:145264365-145264387 CCCACTGCTGTGTGGGTCCTTGG + Intergenic
982296548 4:153834971-153834993 GCCAGCTCTCTGCGGGTCTTTGG + Intergenic
982598329 4:157413959-157413981 CCCAGGGCCCTGTGGGGTCTGGG - Intergenic
983337974 4:166420691-166420713 CCCAGGGCTCTGCTGGTCTCAGG - Intergenic
983534177 4:168839633-168839655 CCCAGGGCTCTGCCAGACCCTGG + Intronic
984058899 4:174966667-174966689 TCCATGGCTCTGCTGGTCATGGG + Intronic
984098020 4:175455277-175455299 TCTGGGGCTCTGGGGGTCCTGGG - Intergenic
985512295 5:319509-319531 CTCAGGTCTCTGCAGGACCTGGG - Intronic
985644421 5:1078293-1078315 CCCAAGGCCCCGGGGGTCCTGGG - Intronic
986199623 5:5569468-5569490 CCCCGGTCTCTGTGGCTCCTGGG + Intergenic
986335689 5:6753665-6753687 CCTTGGGCTCTGCGGATGCTCGG + Intronic
988621859 5:32831382-32831404 TCCAGGGCTCAGCGTGTCTTTGG - Intergenic
989074543 5:37550113-37550135 CCCAGGGCTCTGGGAGGCCATGG - Intronic
989632920 5:43505377-43505399 CACAGGGCTCTGTGGGCCCAGGG - Intronic
990532501 5:56688227-56688249 CGCAGGGCTCAGCTGTTCCTAGG + Intergenic
990563244 5:57004378-57004400 CCAAGGCCTCTGCTGGTCCTGGG + Intergenic
995849376 5:116529015-116529037 GCCAAGGCTCTGCTGGTACTGGG + Intronic
996205160 5:120725403-120725425 CCCAGTGCTTTGCGAGTCCAAGG + Intergenic
997211586 5:132080077-132080099 CCCAGTGCTCTGCGGGTGTGAGG - Intergenic
998139654 5:139692760-139692782 CCCAGGACTCTGCTGCTTCTAGG - Intergenic
999270497 5:150294020-150294042 CCCAGGGTCCTGCAGGGCCTGGG + Intergenic
1001724448 5:173885304-173885326 CCCTGGGCTCTGGGTATCCTGGG + Intergenic
1001926481 5:175640666-175640688 CTCAGGCCTCTGTGGGGCCTGGG + Intergenic
1002453137 5:179331030-179331052 CTCTGGGCTCTGTGGGACCTGGG + Intronic
1003035437 6:2637258-2637280 CCCAGGGCTTTGCTTGACCTCGG - Intergenic
1003073304 6:2961402-2961424 CCCAGGGCTCTGCGGAATCCTGG - Intronic
1004140141 6:13010632-13010654 ACCTGGGATCTGCTGGTCCTTGG + Intronic
1005911990 6:30318671-30318693 CCCAGGGCTCTGGGAGGCCAAGG + Intergenic
1006078168 6:31547653-31547675 CCTACGGCTCTGGGGGTACTTGG + Exonic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1007077769 6:39078792-39078814 GGCAGGGCTCTGTGGGTCCATGG + Intronic
1007632720 6:43281811-43281833 CCCAGGGCATTGCGGGTGCCTGG + Intronic
1007727529 6:43925544-43925566 CCCAAGGCTTTGCAGGTGCTGGG - Intergenic
1013147405 6:107407947-107407969 CCCAGCGCTTTGGGAGTCCTAGG - Intronic
1015577629 6:134689948-134689970 CTCAGGGATCTGTGGTTCCTGGG - Intergenic
1017468963 6:154720928-154720950 CCCAGTGCTCTGGGAGTCCCAGG - Intergenic
1018904758 6:168069213-168069235 CCCCTGGCTCTGAGGGTCCTTGG - Intronic
1019324082 7:429523-429545 CCCAGGGCTCAGCGGATCCCAGG - Intergenic
1022516534 7:30978269-30978291 CCATGGGCCCTGGGGGTCCTGGG + Intronic
1023296925 7:38724840-38724862 CCCAGGGCTTTGGGAGGCCTTGG - Exonic
1024533400 7:50410896-50410918 CACAGGGCCCTGCTGGTCCTGGG + Intergenic
1025085442 7:56019717-56019739 CCCATGGCTCGCCGTGTCCTAGG + Exonic
1028294880 7:89116162-89116184 CCCAGGACTCTGGGAGGCCTAGG - Intronic
1029485468 7:100837191-100837213 CCCAGCGCTTTGCGGGGCCAAGG - Intronic
1029700730 7:102245292-102245314 CCCAGGGCTTTGGGAGGCCTGGG - Intronic
1032094565 7:128931468-128931490 CCCAGTGCTCTGGCGGTTCTGGG - Intergenic
1032237262 7:130136140-130136162 CACAGGGCTCAGCAGCTCCTGGG - Intergenic
1033244577 7:139707304-139707326 CTCAGGGCTTTGCGGGTATTGGG - Intronic
1033767961 7:144515323-144515345 CCCAGGGCTCTTAGAGTCCTGGG + Intronic
1034202526 7:149291324-149291346 CCCAGGGCTGAGCAGCTCCTAGG + Intronic
1034976099 7:155450015-155450037 CCCCGGGCTCTCCGGGTCCCGGG - Intergenic
1035028667 7:155843683-155843705 GCCAGGGCTGTGGGGTTCCTGGG + Intergenic
1035344709 7:158190578-158190600 CACAGGGCTCTGTGGGCCCCAGG - Intronic
1035423073 7:158745574-158745596 CCCAGAGCACTGCCTGTCCTGGG - Intronic
1035583453 8:754601-754623 CCCAGTGCTCTGCGAGGCCAAGG + Intergenic
1035712807 8:1731409-1731431 CCTAGGGTTCTGCGGGTCTCCGG - Intergenic
1036291497 8:7496548-7496570 CCCAGGGCTCTGGGAGGCCGAGG - Intronic
1036329992 8:7814995-7815017 CCCAGGGCTCTGGGAGGCCGAGG + Intronic
1036489178 8:9209053-9209075 CCCAGGGCTCTGAGAGGCCAAGG - Intergenic
1036697389 8:10985854-10985876 CCCAGCGCTCTGGGAGTCCAAGG - Intronic
1037782550 8:21880326-21880348 CCCAGGGCTTTGGGAGGCCTAGG + Intergenic
1038318948 8:26511412-26511434 CTCAGGTCTCTGGGGCTCCTGGG - Intronic
1043700700 8:83284975-83284997 CCCAGGACTCTGGGAGTCCAAGG - Intergenic
1047604986 8:126465906-126465928 CCCAGCACTCTGTGAGTCCTAGG + Intergenic
1047750416 8:127876328-127876350 CCCAGAGCTCTGTGGGAACTGGG - Intergenic
1048497352 8:134946334-134946356 CCCAGGGCCCTGTGGCTCCATGG - Intergenic
1049200624 8:141338617-141338639 CCCAAGGCCCTGAGTGTCCTAGG + Intergenic
1049218479 8:141418231-141418253 CCCGGGGCTCAGCGGGTCTCAGG - Intronic
1049382357 8:142323652-142323674 CCAAGTGCCCTGCTGGTCCTGGG - Intronic
1049446854 8:142635187-142635209 CCCAGGGCTGGGCGGGAGCTGGG - Intergenic
1049514255 8:143045056-143045078 CCCAGGACTCAGTGAGTCCTCGG + Intronic
1049552486 8:143267062-143267084 TCCAGGCCTCCGGGGGTCCTCGG - Intronic
1049773803 8:144395612-144395634 CCCAGGGCTCTTGGCGGCCTGGG - Intronic
1055234247 9:74100483-74100505 CCCAGCGCTTTGGGGGTCCAAGG - Intergenic
1055539646 9:77290030-77290052 CCCAGCACTCTGGGGGGCCTAGG - Intronic
1058295621 9:103303321-103303343 CCCAGGGCTAAGCGAGGCCTAGG - Intergenic
1060272860 9:122159536-122159558 CCTTGGGCTCCGCGGATCCTGGG - Intronic
1060551814 9:124489189-124489211 GCCAGGGCTCTGTCTGTCCTTGG - Intronic
1060817727 9:126644142-126644164 CGCTGGTCTCTCCGGGTCCTCGG + Intronic
1061318467 9:129812804-129812826 CACAGGGATCTGAGGATCCTAGG - Intergenic
1061371243 9:130198741-130198763 CACAGGGCACTGTGTGTCCTTGG - Intronic
1061583916 9:131554593-131554615 CGCGGGGCTCCGGGGGTCCTCGG - Intergenic
1061768274 9:132896647-132896669 CCCCGGGCGCTGCTGGGCCTGGG + Exonic
1061904917 9:133691853-133691875 CCCAGGGCTCTGCGGGTCCTGGG - Intronic
1062247061 9:135574550-135574572 CTCAGGGTTCAGCGGGTCCTGGG + Intergenic
1189337964 X:40182267-40182289 CCCAGGGCTCTCCAGGGACTGGG - Intergenic
1190134384 X:47782162-47782184 CACATGGCTCGGAGGGTCCTAGG + Intergenic
1194240195 X:91435734-91435756 CCCAGGGGGCTGCGGGTCACCGG - Exonic
1195063538 X:101219208-101219230 CCCAGGTCTCTGAGGGTGTTTGG + Intergenic
1195239185 X:102934280-102934302 CCAAGGGGTCTGCTGTTCCTAGG - Intergenic
1195341768 X:103913595-103913617 CCCAGGACACAGCGGGGCCTTGG - Intergenic
1198335925 X:135666651-135666673 CTCAGGGCTCTGCAGGTGCAAGG + Intergenic
1198882113 X:141292816-141292838 CCCAGGACTCTGGGGGGCCGAGG - Intergenic