ID: 1061905521

View in Genome Browser
Species Human (GRCh38)
Location 9:133694708-133694730
Sequence TAGGAGCCCCAGAATGAACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061905521_1061905530 20 Left 1061905521 9:133694708-133694730 CCCCGTTCATTCTGGGGCTCCTA 0: 1
1: 0
2: 0
3: 10
4: 73
Right 1061905530 9:133694751-133694773 GAAGACTCCATAAATGTCTGTGG No data
1061905521_1061905524 -10 Left 1061905521 9:133694708-133694730 CCCCGTTCATTCTGGGGCTCCTA 0: 1
1: 0
2: 0
3: 10
4: 73
Right 1061905524 9:133694721-133694743 GGGGCTCCTAGCTCCGTGCCTGG No data
1061905521_1061905526 -4 Left 1061905521 9:133694708-133694730 CCCCGTTCATTCTGGGGCTCCTA 0: 1
1: 0
2: 0
3: 10
4: 73
Right 1061905526 9:133694727-133694749 CCTAGCTCCGTGCCTGGTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061905521 Original CRISPR TAGGAGCCCCAGAATGAACG GGG (reversed) Intronic
900087662 1:906093-906115 CAGGAGGCCCAGAAGGAGCGGGG - Intergenic
902658613 1:17886391-17886413 GAGGAGCCCAAGGATGTACGAGG - Intergenic
907438533 1:54464453-54464475 ATGGAGCCCTAGAATGAAGGGGG + Intergenic
917753770 1:178078824-178078846 TAGGACCCCCAGAAACAATGTGG - Intergenic
918016141 1:180634101-180634123 GAGGAGTCCCAGAATCAATGTGG - Intronic
922853489 1:228754880-228754902 CAGGAGGCTCAGAATGAACTGGG + Intergenic
924106239 1:240652090-240652112 TGGGAGACCCAGAATGAAGTGGG + Intergenic
1062977394 10:1694897-1694919 AAGGAGCCCCAGGATGCACGTGG - Intronic
1067028980 10:42867845-42867867 CAGGAGCCCCAGAGTGCACCTGG - Intergenic
1069520764 10:69118502-69118524 TAGAAGACCCAGGATGAAAGAGG + Intergenic
1070781952 10:79142794-79142816 GAGGAGCCCCAGAAAGCAGGAGG - Intronic
1071948924 10:90680569-90680591 AATGAGCCTCAGAATGAAAGAGG - Intergenic
1072525068 10:96264093-96264115 TAGGAAACCCAGCATAAACGTGG + Intronic
1073795874 10:106987762-106987784 AAGGAGCCCCAGAGTGATAGTGG - Intronic
1085063264 11:73468435-73468457 AAGGAGCCCCAGGCTGCACGGGG + Exonic
1091583843 12:1805027-1805049 TAGGAGCCCCAGACCGCCCGTGG + Intronic
1101424805 12:104579181-104579203 TAGGAGCCCAGGAATGGAGGAGG - Intronic
1102602468 12:114042402-114042424 TAGGGCTCCCAGAATGAACAAGG - Intergenic
1108488193 13:50950010-50950032 TAGCAGCCTGAGAATGAATGAGG - Intronic
1113767161 13:112888734-112888756 TGGGAGCCCCAGCATCAGCGCGG - Intergenic
1118156605 14:63248683-63248705 GTGGAGCCACAGAATGAACAAGG + Intronic
1119040760 14:71272225-71272247 GAGGAGCCACAGAAGGAACCTGG - Intergenic
1124902474 15:33837191-33837213 TAGGAAAGCCAGAATGAACTGGG + Intronic
1125761724 15:42100697-42100719 CAGTAGCCCTAGAATGAATGAGG - Intergenic
1135946184 16:26867024-26867046 CATGAGCCCCAGAATCAATGAGG + Intergenic
1137884532 16:52088384-52088406 TAGAAGCCACAGAAAGAAGGAGG + Intergenic
1141155214 16:81592585-81592607 TGGGAGCCCCAGGATGAGCAGGG - Intronic
1149432224 17:56603506-56603528 TTGGAGCCCCAGATAGAACCTGG - Intergenic
1160685016 19:430632-430654 GAGGAGCCCCAGAATCCTCGTGG + Intronic
1163675078 19:18651661-18651683 TTGAAGCCCCAGAAGGGACGGGG - Intronic
925302326 2:2826227-2826249 CAGGAGCTCCAGAACCAACGGGG + Intergenic
927099154 2:19774652-19774674 GAGGAGCCACAGAATGAATGAGG - Intergenic
928004966 2:27556435-27556457 TAGGAGTCCCAGAAGGAAAGGGG - Intronic
929923241 2:46188558-46188580 AAGGAGTCCCAGAGTGAAGGAGG - Intergenic
931087651 2:58851320-58851342 TACAAGCCCCAGAATGAATCTGG - Intergenic
932884138 2:75532663-75532685 CTGGAGCTCCAGAATGAAAGAGG + Intronic
933693622 2:85198573-85198595 TTGGGGCTCCAGAATGAATGGGG + Intronic
934685607 2:96319146-96319168 TAGTGGCCCCAGAAGGAACATGG - Intergenic
935755036 2:106270270-106270292 TAGGAGCCACCGAGTGGACGTGG - Intergenic
1170411190 20:16093894-16093916 TAGGAGCCCCAGAATAAGCATGG - Intergenic
1170879133 20:20279060-20279082 GAGGTGCTCCAGAATAAACGTGG - Intronic
1176157483 20:63628932-63628954 TTGGAGCCCCAGAGTGAAGGAGG - Intergenic
1176228809 20:64019883-64019905 AAGGAGCCCCAGCATGAAAATGG - Intronic
1178949688 21:36975846-36975868 CAGGAGGTGCAGAATGAACGTGG - Intronic
1181677471 22:24465545-24465567 TAGGAGGCCCAGATTGAACTGGG - Intergenic
949867944 3:8562226-8562248 AAGGAGCCCCAGATGGAAAGAGG + Intronic
950443889 3:13025166-13025188 AAGGAGCCCCAGAAAGAGTGGGG + Intronic
951118615 3:18895885-18895907 TAGCAGTCCTAGAATGAAAGTGG + Intergenic
952689247 3:36184987-36185009 TAGGAGCCCCAGAAACAGAGAGG - Intergenic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG + Intronic
956738216 3:72255452-72255474 CAGGAGCCCCACAAGGAAGGGGG + Intergenic
967795395 3:193593432-193593454 AAGAGGCCCCAGAATTAACGGGG - Intronic
976397468 4:84571544-84571566 TTTGAGCCCCAGACTGAAGGAGG - Intergenic
981527354 4:145720080-145720102 TTGTGGCCCCAGAATGAAGGTGG + Intronic
985042795 4:185908752-185908774 TAGGAGACCCACAATGATGGAGG + Intronic
985206036 4:187538131-187538153 TAGGAGGCACAGCATGAACTGGG - Intergenic
986098631 5:4584892-4584914 TAGGACCCCAAGTATGAAGGTGG + Intergenic
990728125 5:58779024-58779046 TAGCAGAGACAGAATGAACGTGG - Intronic
995188981 5:109300610-109300632 GAGGAGCCTCAGAATGAACAGGG - Intergenic
997231459 5:132247153-132247175 TTGGAGTCCCAGAAGGAAAGGGG + Intronic
999272815 5:150307498-150307520 TAGGTGCCCCAGTATCAAGGAGG - Intronic
1000195520 5:158953766-158953788 CAGGAGCCCCAGAATCAAAGAGG + Intronic
1002534750 5:179870035-179870057 TAGCAGCCCCAGACTGCATGAGG + Intronic
1007508619 6:42358029-42358051 CAGGAGCCCCAGAAAGGAAGGGG - Intronic
1008876392 6:56334247-56334269 TAGTAGCACCAGCATGAACTGGG + Intronic
1012054906 6:94393881-94393903 AAGAAGCCCCAGAATAAACAAGG + Intergenic
1017747047 6:157456347-157456369 TGGCAGCCCCAGGATGAACGAGG - Intronic
1020083253 7:5297541-5297563 TGAGACCCTCAGAATGAACGTGG - Intronic
1024094646 7:45974149-45974171 TAGGCTCTCCAGAATGAAAGGGG - Intergenic
1027694494 7:81392590-81392612 TAGGGGCCCCAGAAGGAATAGGG + Intergenic
1027959507 7:84927469-84927491 TAAGTTCCTCAGAATGAACGTGG + Intergenic
1035333100 7:158108882-158108904 GAGGAGCCACTGAGTGAACGAGG + Intronic
1047673129 8:127170701-127170723 TATGAACCTCAGAATGAATGAGG - Intergenic
1048617493 8:136093496-136093518 TAAGAGCCCCAGAATGACAAGGG - Intergenic
1050356815 9:4791925-4791947 CATGAGTCCCAGAATGCACGGGG - Intergenic
1050984696 9:12067480-12067502 TAGGAACAAGAGAATGAACGGGG - Intergenic
1061905521 9:133694708-133694730 TAGGAGCCCCAGAATGAACGGGG - Intronic
1061939198 9:133875015-133875037 GAGCAGCCCCAGAAAGAACAAGG + Intronic
1189698009 X:43685669-43685691 CAGTAGCCCCAGAATCAACTGGG + Intronic
1197082758 X:122439549-122439571 AAGGAGCCCCACAAGGACCGGGG - Intergenic
1199622035 X:149710768-149710790 TAGAAGCCCAAGACTGAACGCGG - Intronic
1199691595 X:150313000-150313022 TAGAATCCCCAGAATGACGGGGG + Intergenic
1200068333 X:153515587-153515609 TGGGAGGCCAAGAAGGAACGTGG + Intergenic