ID: 1061905521

View in Genome Browser
Species Human (GRCh38)
Location 9:133694708-133694730
Sequence TAGGAGCCCCAGAATGAACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061905521_1061905524 -10 Left 1061905521 9:133694708-133694730 CCCCGTTCATTCTGGGGCTCCTA No data
Right 1061905524 9:133694721-133694743 GGGGCTCCTAGCTCCGTGCCTGG No data
1061905521_1061905530 20 Left 1061905521 9:133694708-133694730 CCCCGTTCATTCTGGGGCTCCTA No data
Right 1061905530 9:133694751-133694773 GAAGACTCCATAAATGTCTGTGG No data
1061905521_1061905526 -4 Left 1061905521 9:133694708-133694730 CCCCGTTCATTCTGGGGCTCCTA No data
Right 1061905526 9:133694727-133694749 CCTAGCTCCGTGCCTGGTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061905521 Original CRISPR TAGGAGCCCCAGAATGAACG GGG (reversed) Intronic