ID: 1061906602

View in Genome Browser
Species Human (GRCh38)
Location 9:133702456-133702478
Sequence CCCCGTATGGGCCCCTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 71}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061906602_1061906607 -10 Left 1061906602 9:133702456-133702478 CCCTTGGAGGGGCCCATACGGGG 0: 1
1: 0
2: 0
3: 11
4: 71
Right 1061906607 9:133702469-133702491 CCATACGGGGCCTGATGCCCAGG No data
1061906602_1061906608 -1 Left 1061906602 9:133702456-133702478 CCCTTGGAGGGGCCCATACGGGG 0: 1
1: 0
2: 0
3: 11
4: 71
Right 1061906608 9:133702478-133702500 GCCTGATGCCCAGGAGCCTGCGG No data
1061906602_1061906612 13 Left 1061906602 9:133702456-133702478 CCCTTGGAGGGGCCCATACGGGG 0: 1
1: 0
2: 0
3: 11
4: 71
Right 1061906612 9:133702492-133702514 AGCCTGCGGCCCCCTTGTCCTGG No data
1061906602_1061906618 29 Left 1061906602 9:133702456-133702478 CCCTTGGAGGGGCCCATACGGGG 0: 1
1: 0
2: 0
3: 11
4: 71
Right 1061906618 9:133702508-133702530 GTCCTGGATCTACTCTGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061906602 Original CRISPR CCCCGTATGGGCCCCTCCAA GGG (reversed) Intronic
900097948 1:947962-947984 CCCCTCATCAGCCCCTCCAAGGG + Intronic
902237700 1:15068311-15068333 CCCCGGCTCGGCCCCTCCAAGGG - Intronic
913495635 1:119425881-119425903 CCCGGTATGGGCCCTTCCATCGG + Intergenic
917752805 1:178069106-178069128 CACCGCATGGGCCTCTCCATAGG + Intergenic
922336523 1:224622980-224623002 ACTCCTATGGGCCCCTCCACTGG + Intronic
1064348813 10:14557804-14557826 CCCCGGCTAGGCCCCTCCAATGG - Intronic
1068258324 10:54543116-54543138 CTCCGAATGGCCCACTCCAAGGG + Intronic
1069901818 10:71710821-71710843 CCCAGTGTGGGCCACTCCATGGG - Intronic
1070147094 10:73782303-73782325 CCCCGGATCTGCCCCTCCAGAGG + Exonic
1070755475 10:78989433-78989455 CTCCACATGGGCCCCTCCATGGG + Intergenic
1072535872 10:96362314-96362336 CCCAGTGAGGGTCCCTCCAATGG + Intergenic
1074078153 10:110148134-110148156 CCCCGTATGGGCCTCTCTGCAGG + Intergenic
1080826446 11:35852968-35852990 CCCCGAGCAGGCCCCTCCAAGGG + Intergenic
1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG + Exonic
1088717152 11:112558927-112558949 CACCATATGGGCCTCTCCATTGG + Intergenic
1089754336 11:120675234-120675256 TCCCCTATGGGACCCTCCCAGGG - Intronic
1095975678 12:47939451-47939473 ACCCGTATGGGACACTCCCAGGG - Intronic
1097233538 12:57525876-57525898 CACCGTGGGGGCCCCTCCCAGGG - Exonic
1097757683 12:63425387-63425409 CCCCGTAGTGGCCCCTCAAATGG - Intergenic
1099833382 12:87874905-87874927 CTACTTATGAGCCCCTCCAAAGG - Intergenic
1101856571 12:108448422-108448444 CTCCGTGTGGGCCTCTCCACGGG + Intergenic
1101977956 12:109378562-109378584 CCCCGTCTGGGCCTCCCAAAAGG + Intronic
1103380796 12:120492817-120492839 CCCCATATGGGCCACTTCAGGGG + Intronic
1104508586 12:129355854-129355876 CTGCGTGAGGGCCCCTCCAAGGG - Intronic
1113160559 13:107376107-107376129 TCCCATCTGGGCCTCTCCAAGGG - Intronic
1118040131 14:61907587-61907609 CACCGTGTGGGCCTCTCCACAGG + Intergenic
1122839813 14:104451712-104451734 CCCTGTGTGTGGCCCTCCAACGG + Intergenic
1123110528 14:105864964-105864986 CCCCGTCAGGGACCCTCCACAGG - Intergenic
1141082132 16:81061761-81061783 CCCTCTGTGGGCCCCTCCACTGG + Exonic
1141820323 16:86441349-86441371 CCCCATATGCGCTCCTCTAATGG - Intergenic
1142011013 16:87714180-87714202 CTCCTGATGGGCCCCTCCAAGGG - Intronic
1142482383 17:227083-227105 CCCCTCCTGGGCCCCTCCACAGG + Intronic
1150674721 17:67234975-67234997 CCTTGTATGGCCCCCTTCAATGG + Intronic
1151336069 17:73440500-73440522 CTCCCTCTGGGCTCCTCCAAGGG + Intronic
1151466215 17:74287143-74287165 CCATGCATGGGCGCCTCCAAAGG + Intronic
1155403755 18:25465577-25465599 CCCCGCAGGGGCCACTCCGAGGG + Intergenic
1160864550 19:1251037-1251059 CCCCCGATGGGCCCCTCCACTGG - Intronic
1163390479 19:17027183-17027205 CCCCTTATGGCCCCCTCCCCGGG + Intergenic
925303102 2:2830818-2830840 CCCCGTATGTGCCACTCCAGAGG + Intergenic
927451778 2:23215073-23215095 CCTCCTATGGGACCCTCCATGGG - Intergenic
938036276 2:128037651-128037673 CCCCTGATGGGACCCTCGAAAGG - Intergenic
1175154732 20:56962815-56962837 CCCCATGTGGGCCCCTCTACAGG - Intergenic
1175635775 20:60581787-60581809 CCCCATATGGGCCTCTGCACAGG + Intergenic
1178353938 21:31894831-31894853 CCCCAAATGGCCCCCTCCATTGG + Intronic
1179034395 21:37747239-37747261 CCCCTTCTGGCCCTCTCCAAAGG - Intronic
1182428951 22:30289189-30289211 CCCCGTGAGGCCCCCTCCCAGGG - Intronic
1182755103 22:32672996-32673018 CCCCATCTGGGGCCCTCCAAAGG - Intronic
950846340 3:16019447-16019469 AAACGTATGGGCCACTCCAAAGG + Intergenic
954917501 3:54161432-54161454 CCTGGTAGGTGCCCCTCCAAGGG - Intronic
955621236 3:60866436-60866458 CCCCATGTGGGCCTCTCCACTGG - Intronic
960384329 3:117002915-117002937 CTCCTTATGGGTTCCTCCAATGG - Intronic
961397355 3:126604815-126604837 CACCATATGGGCCTCTCCATAGG + Intronic
961911667 3:130323678-130323700 CTCCGCAGGGGCCTCTCCAAGGG - Intergenic
963081907 3:141402446-141402468 CCCCGTAAGTGCCCCTCGCAGGG + Intronic
972554018 4:40162944-40162966 CCCCATGTGGGCCTCTCCAAAGG + Intergenic
991517755 5:67457674-67457696 TCCCATGTGGGCCTCTCCAAAGG - Intergenic
993898825 5:93570923-93570945 CCTTGTAGGGGCCCCTCCGAGGG - Intergenic
993898828 5:93570924-93570946 CCTCGGAGGGGCCCCTACAAGGG + Intergenic
1001570173 5:172725657-172725679 CCCCAAATGCACCCCTCCAAAGG + Intergenic
1002423470 5:179162551-179162573 TACCGTATGGGCCCCTCCTGGGG + Intronic
1003606061 6:7562085-7562107 CTCCCTATGGGCCACTTCAAAGG - Intronic
1007949957 6:45862723-45862745 CCTCATATGGGCCCTTCCCAAGG + Intergenic
1009933026 6:70198960-70198982 CCCCACATGGGCCTCTCCACAGG + Intronic
1018513910 6:164557109-164557131 CCCTGCAAGGGCCCCTTCAAAGG + Intergenic
1022060215 7:26785888-26785910 GCCTGTATGGGCCTCTTCAATGG - Intronic
1022978582 7:35580860-35580882 CTCCATATGGGCCACTCCACAGG + Intergenic
1026766959 7:73166175-73166197 CTCCATATGGGCCTCTCCATGGG - Intergenic
1027043444 7:74975911-74975933 CTCCATATGGGCCTCTCCATGGG - Intronic
1027080202 7:75226448-75226470 CTCCATATGGGCCTCTCCATGGG + Intergenic
1029389408 7:100265055-100265077 CTCCATATGGGCCTCTCCATGGG + Intronic
1033097729 7:138445494-138445516 AAACGTATGGGCCACTCCAAAGG + Intergenic
1037716961 8:21408835-21408857 GCCCCTCTGGGCTCCTCCAAAGG + Intergenic
1041921709 8:63189222-63189244 CCCCATATGGGCCACTCAATAGG - Intronic
1042902137 8:73739992-73740014 TGCCATATGGGCCTCTCCAAAGG - Intronic
1048402690 8:134086606-134086628 CCTTGTATGGTCCCATCCAAGGG - Intergenic
1055447619 9:76398634-76398656 CGCCGTATGGGCCCCTCTGTAGG - Intergenic
1056162889 9:83915292-83915314 ACCAATATGGCCCCCTCCAATGG + Exonic
1056357460 9:85816243-85816265 ACCAATATGGCCCCCTCCAATGG - Intergenic
1061218506 9:129235659-129235681 TCCCTACTGGGCCCCTCCAAGGG + Intergenic
1061278568 9:129583810-129583832 GTCCGTATGGGCCCCTTAAAGGG - Intergenic
1061906602 9:133702456-133702478 CCCCGTATGGGCCCCTCCAAGGG - Intronic
1062281743 9:135754953-135754975 CTCCTTATGGTCCCCTCCAAAGG + Intronic
1062432441 9:136532119-136532141 CTCCTTATGGGCCCCTCCCAGGG - Intronic