ID: 1061909916

View in Genome Browser
Species Human (GRCh38)
Location 9:133717025-133717047
Sequence GTCTAGGGATGAAGAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061909914_1061909916 -8 Left 1061909914 9:133717010-133717032 CCAGGGACAAGTCAAGTCTAGGG 0: 1
1: 0
2: 0
3: 15
4: 78
Right 1061909916 9:133717025-133717047 GTCTAGGGATGAAGAAGCCCAGG No data
1061909907_1061909916 29 Left 1061909907 9:133716973-133716995 CCCGCTATTCCCATTTTACAGAT 0: 1
1: 5
2: 29
3: 159
4: 617
Right 1061909916 9:133717025-133717047 GTCTAGGGATGAAGAAGCCCAGG No data
1061909909_1061909916 20 Left 1061909909 9:133716982-133717004 CCCATTTTACAGATGAAAACACA 0: 3
1: 23
2: 362
3: 2305
4: 7761
Right 1061909916 9:133717025-133717047 GTCTAGGGATGAAGAAGCCCAGG No data
1061909908_1061909916 28 Left 1061909908 9:133716974-133716996 CCGCTATTCCCATTTTACAGATG 0: 1
1: 17
2: 108
3: 430
4: 1124
Right 1061909916 9:133717025-133717047 GTCTAGGGATGAAGAAGCCCAGG No data
1061909910_1061909916 19 Left 1061909910 9:133716983-133717005 CCATTTTACAGATGAAAACACAG 0: 3
1: 29
2: 378
3: 2360
4: 8299
Right 1061909916 9:133717025-133717047 GTCTAGGGATGAAGAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061909916 Original CRISPR GTCTAGGGATGAAGAAGCCC AGG Intronic
No off target data available for this crispr